Human OR2A4 cDNA Clone BC120953 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016532HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2A4
Gene ID:
79541
Accession #:
BC120953
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2A4 cDNA Clone BC120953 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2A4

Gene ID: 79541

Accession Number: BC120953

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGAGACAATATAACATCCATCAGAGAGTTCCTCCTACTGGGATTTCCCGTTGGCCCAAGGATTCAGATGCTCCTCTTTGGGCTCTTCTCCCTGTTCTACGTCTTCACCCTGCTGGGGAACGGGACCATACTGGGGCTCATCTCACTGGACTCCAGACTGCACGCCCCCATGTACTTCTTCCTCTCACACCTGGCGGTCGTCGACATCGCCTACGCCTGCAACACGGTGCCCCGGATGCTGGTGAACCTCCTGCATCCAGCCAAGCCCATCTCCTTTGCGGGCCGCATGATGCAGACCTTTCTGTTTTCCACTTTTGCTGTCACAGAATGTCTCCTCCTGGTGGTGATGTCCTATGATCTGTACGTGGCCATCTGCCACCCCCTCCGATATTTGGCCATCATGACCTGGAGAGTCTGCATCACCCTCGCGGTGACTTCCTGGACCACTGGAGTCCTTTTATCCTTGATTCATCTTGTGTTACTTCTACCTTTACCCTTCTGTAGGCCCCAGAAAATTTATCACTTTTTTTGTGAAATCTTGGCTGTTCTCAAACTTGCCTGTGCAGATACCCACATCAATGAGAACATGGTCTTGGCCGGAGCAATTTCTGGGCTGGTGGGACCCTTGTCCACAATTGTAGTTTCATATATGTGCATCCTCTGTGCTATCCTTCAGATCCAATCAAGGGAAGTTCAGAGGAAAGCCTTCCGCACCTGCTTCTCCCACCTCTGTGTGATTGGACTCGTTTATGGCACAGCCATTATCATGTATGTTGGACCCAGATATGGGAACCCCAAGGAGCAGAAGAAATATCTCCTGCTGTTTCACAGCCTCTTTAATCCCATGCTCAATCCCCTTATCTGTAGTCTTAGGAACTCAGAAGTGAAGAATACTTTGAAGAGAGTGCTGGGAGTAGAAAGGGCTTTATGA

Length: 933

View AllClose

0 Reviews

View AllClose