Human OR1E2 cDNA Clone BC121105 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016495HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR1E2
Gene ID:
8388
Accession #:
BC121105
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR1E2 cDNA Clone BC121105 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR1E2

Gene ID: 8388

Accession Number: BC121105

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATGGGACAAAATCAAACCAGCATCTCAGACTTCCTGCTCCTGGGCCTGCCCATCCAACCAGAGCAGCAAAACCTGCGCTATGCCCTGTTCTTGGCCATGTATCTTACCACCCTCCTGGGGAACCTCCTCATCATTGTCCTCATTCGACTGGACTCCCATCTCCACACGCCTGTGTATTTGTTTCTCAGCAACTTGTCCTTCTCTGACCTCTGCTTTTCCTCAGTCACAATGCCCAAATTGCTGCAGAACATGCAGAACCAAGACCCATCCATCCCCTATGCAGACTGCCTGACCCAAATGTACTTCTTCTTGTATTTTTCGGATCTAGAGAGCTTCCTCCTTGTGGCCATGGCCTATGACCGCTATGTGGCCATCTGCTTCCCCATGCACTACACCGCCATCTGCTTCCTCCTGCACTACACCGCCATCATGAGCCCCATGCTCTGTCTCTCCGTGGTGGCGCTGTCCTGGGTGCTGACCACCTTCCATGCCATGTTACACACTTTACTCATGGCCAGGTTGTGTTTTTGTGCAGACAATGTGATCCCCCACTTTTTCTGTGATATGTCTGCTCTGCTGAAGCTGGCCTGCTCTGACACTCGAGTTAATGAATGGGTGATATTTATCATGGGAGGGCTCATTCTTGTCATCCCATTCCTACTCATCCTTGGGTCCTATGCAAGAATTGTCTCCTCCATCCTCAAGGTCCCTTCTTCTAAGGGTATCTGCAAGGCCTTCTCTACTTGTGGCTCCCACCTCTCTGTGGTGTCACTGTTCTATGGGACCGTTATTGGTCTCTACTTATGCCCATCAGCTAATAGTTCTACTCTAAAGGACACTGTCATGGCTATGATGTACACTGTGGTGACCCCCATGCTGACCCCCTTCATCTACAGCCTGAGGAACAGAGACATGAAGGGAGCCCTGGAAAGGGTCATTTGTAAAAGGAAAAATCCCTTCCTTCTATGA

Length: 972

View AllClose

0 Reviews

View AllClose