Human OR1D2 cDNA Clone BC106735 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016490HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR1D2
Gene ID:
4991
Accession #:
BC106735
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR1D2 cDNA Clone BC106735 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR1D2

Gene ID: 4991

Accession Number: BC106735

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGATGGAGGCAACCAGAGTGAAGGTTCAGAGTTCCTTCTCCTGGGGATGTCAGAGAGTCCTGAGCAGCAGCGGATCCTGTTTTGGATGTTCCTGTCCATGTACCTGGTCACGGTGGTGGGAAATGTGCTCATCATCCTGGCCATCAGCTCTGATTCCCGCCTGCACACCCCCGTGTACTTCTTCCTGGCCAACCTCTCCTTCACTGACCTCTTCTTTGTCACCAACACAATCCCCAAGATGCTGGTGAACCTCCAGTCCCATAACAAAGCCATCTCCTATGCAGGGTGTCTGACACAGCTCTACTTCCTGGTCTCCTTGGTGGCCCTGGACAACCTCATCCTGGCTGTGATGGCATATGACCGCTATGTGGCCATCTGCTGCCCCCTCCACTACACCACAGCCATGAGCCCTAAGCTCTGTATCTTACTCCTTTCCTTGTGTTGGGTCCTATCCGTCCTCTATGGCCTCATACACACCCTCCTCATGACCAGAGTGACCTTCTGTGGGTCACGAAAAATCCACTACATCTTCTGTGAGATGTATGTATTGCTGAGGATGGCATGTTCCAACATTCAGATTAATCACACAGTGCTGATTGCCACAGGCTGCTTCATCTTCCTCATTCCCTTTGGATTCGTGATCATTTCCTATGTGCTGATTATCAGAGCCATCCTCAGAATACCCTCAGTCTCTAAGAAATACAAAGCCTTCTCCACCTGTGCCTCCCATTTGGGTGCAGTCTCCCTCTTCTATGGGACACTTTGTATGGTATACCTAAAGCCCCTCCATACCTACTCTGTGAAGGACTCAGTAGCCACAGTGATGTATGCTGTGGTGACACCCATGATGAATCCCTTCATCTACAGCCTGAGGAACAAGGACATGCATGGGGCTCTGGGAAGACTCCTAGATAAACACTTTAAGAGGCTGACATGA

Length: 939

View AllClose

0 Reviews

View AllClose