Human OR1A1 cDNA Clone BC141934 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL865201HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR1A1
Gene ID:
8383
Accession #:
BC141934
Plasmid:
pUC
€341.00
Frequently bought together:

Description

Human OR1A1 cDNA Clone BC141934 pUC Plasmid | Cusabio

Gene Name: OR1A1

Gene ID: 8383

Accession Number: BC141934

Vector: pUC

Sequence: ATGAGGGAAAATAACCAGTCCTCTACACTGGAATTCATCCTCCTGGGAGTTACTGGTCAGCAGGAACAGGAAGATTTCTTCTACATCCTCTTCCTGTTCATTTACCCCATCACATTGATTGGAAACCTGCTCATCGTCCTAGCCATTTGCTCTGATGTTCGCCTTCACAACCCCATGTATTTTCTCCTTGCCAACCTCTCCTTGGTTGACATCTTCTTCTCATCGGTAACCATCCCTAAGATGCTGGCCAACCATCTCTTGGGCAGCAAATCCATCTCTTTTGGGGGATGCCTAACGCAGATGTATTTCATGATAGCCTTGGGTAACACAGACAGCTATATTTTGGCTGCAATGGCATATGATCGAGCTGTGGCCATCAGCCGCCCACTTCACTACACAACAATTATGAGTCCACGGTCTTGTATCTGGCTTATTGCTGGGTCTTGGGTGATTGGAAATGCCAATGCCCTCCCCCACACTCTGCTCACAGCTAGTCTGTCCTTCTGTGGCAACCAGGAAGTGGCCAACTTCTACTGTGACATTACCCCCTTGCTGAAGTTATCCTGTTCTGACATCCACTTTCATGTGAAGATGATGTACCTAGGGGTTGGCATTTTCTCTGTGCCATTACTATGCATCATTGTCTCCTATATTCGAGTCTTCTCCACAGTCTTCCAGGTTCCTTCCACCAAGGGCGTGCTCAAGGCCTTCTCCACCTGTGGTTCCCACCTCACGGTTGTCTCTTTGTATTATGGTACGGTCATGGGCACGTATTTCCGCCCTTTGACCAATTATAGCCTAAAAGACGCAGTGATCACTGTAATGTACACGGCAGTGACCCCAATGTTAAATTCTTTCATCTACAGTCTGAGAAATCGGGACATGAAGGCTGCCCTGCGGAAACTCTTCAACAAGAGAATCTCCTCGTAA

Length: 930

View AllClose

0 Reviews

View AllClose