Human OR10W1 cDNA Clone BC132848 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL818793HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR10W1
Gene ID:
81341
Accession #:
BC132848
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human OR10W1 cDNA Clone BC132848 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR10W1

Gene ID: 81341

Accession Number: BC132848

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAATTTGTGTTCCTGGCCTATCCCTCCTGCCCAGAACTGCATATTCTGTCCTTCCTTGGGGTCAGCCTGGTTTATGGTTTGATCATCACTGGGAACATTCTCATTGTGGTGTCCATTCACACAGAAACCTGTCTATGCACATCCATGTACTATTTCCTGGGCAGCCTTTCTGGGATTGAAATATGCTACACTGCAGTGGTGGTGCCCCATATCCTGGCCAACACCCTACAGTCAGAGAAGACCATCACTCTCCTGGGCTGTGCCACCCAGATGGCTTTCTTCATTGCACTGGGCAGTGCTGATTGCTTCCTCTTGGCTGCCATGGCCTATGACCGCTATGTGGCCATTTGCCACCCGTTGCAGTACCCTCTCCTCATGACATTGACTCTTTGTGTCCACTTGGTTGTGGCATCAGTCATCAGTGGTCTGTTCCTGTCCTTACAACTGGTGGCCTTCATCTTCTCTCTGCCATTCTGCCAGGCTCAGGGCATTGAGCACTTCTTTTGTGATGTGCCACCAGTCATGCATGTTGTTTGTGCTCAGAGTCACATTCATGAGCAGTCAGTGCTGGTGGCAGCCATACTAGCCATTGCTGTGCCTTTCTTCCTCATCACCACCTCCTACACCTTCATAGTGGCTGCTCTGCTCAAGATCCACTCGGCTGCTGGCCGCCACCGGGCCTTCTCCACCTGCTCTTCCCACCTCACTGTGGTGCTGCTGCAGTATGGCTGCTGTGCCTTCATGTACCTGTGCCCCAGCTCCAGCTACAACCCCAAGCAAGATCAGTTCATCTCACTGGTGTACACATTGGGAACCCCACTGCTCAACCCACTTATCTATGCCCTGAGGAACAGTGAGATGAAAGGGGCCGTAGGGAGAGTTCTTACCAGGAACTGCCTTTCCCAGAACAGCTAG

Length: 918

View AllClose

0 Reviews

View AllClose