Human OR10H3 cDNA Clone BC113844 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016397HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR10H3
Gene ID:
26532
Accession #:
BC113844
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR10H3 cDNA Clone BC113844 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR10H3

Gene ID: 26532

Accession Number: BC113844

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCTGGTCAGAACTACAGAACCATATCTGAATTTATCCTCTCTGGCTTCTCAGCCTTCCCCCAGCAGCTCCTGCCTGTCTTGTTCCTGCTGTACCTCCTGATGTTCCTGTTCACATTGCTTGGCAACCTTCTTATCATGGCCACAGTTTGGATTGAACGCAGACTCCACACACCCATGTACCTCTTCTTGTGTGCCCTCTCCATCTCTGAGATTCTGTTCACTGTTGCCATCACCCCTCGCATGCTGGCTGATCTGCTCTTCACCCATCGTTCCATCACCTTTGTGGCTTGTGCCATTCAGATGTTCTTCTCCTTCATGTTTGGCTTCACTCACTCCTTCCTTCTCATGGTCATGGGCTATGATCACTACGTGACCATCTGCCACCCACTGCATTACAACATGCTAATGAGTCCCCGTGGCTGTGCCCATCTTGTGGCCTGGACCTGGGCTGGTGGCTCGGTCATGGGGATGATGGTGACAATGATGGTTTTTCACCTCACTTTCTGTGGGTCTAATGTGATCCACCATTTTCTCTGTCATGTGCTTTCCCTCTTGAAGTTGGCCTGTGGGAGCAAGACATCATCTGTCATCATGGGTGTGATGCTGGTGTGTGTCACAGCCCTGATAGGCTGTTTGTTCCTCATCATCCTCTCCTTTGTCTTCATTATGGCTGCCATCTTGAGGATTCCTTCTGCTGAGGGCCGGCACAAGACTTTCTCCACTTGTGTATCCCACCTCACTGTGGTGGTCATGCACTATAGTTTTGCCTCCCTTATCTACCTCAAACCCAAGGGCCTCCATTCTATGTACAGTGATGCCTTGATGGCCACCACCTATACTGTCTTCACCCCCTTCCTCAGCCCAATCATTTTCAGTCTAAGGAACAAGGAGCTGAAGAATGCCATAAATAAAAACTTTTGCAGAAGGTTCTGCCCTCTAAGCTCCTAA

Length: 951

View AllClose

0 Reviews

View AllClose