Human OR10H2 cDNA Clone BC113647 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016396HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR10H2
Gene ID:
26538
Accession #:
BC113647
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human OR10H2 cDNA Clone BC113647 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR10H2

Gene ID: 26538

Accession Number: BC113647

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCTGGGGCTAAACCACACCTCCATGTCTGAATTCATCCTCGTCGGCTTCTCTGCCTTCCCCCACCTCCAACTGATGCTCTTCCTGCTGTTCCTGCTGATGTACCTGTTCACACTGCTGGGCAACCTGCTCATCATGGCCACCGTCTGGAGCGAGCGCAGCCTCCACACGCCCATGTACCTCTTCCTGTGCGTCCTCTCAGTCTCCGAGATCCTCTACACCGTGGCCATCATCCCGCGCATGCTGGCCGACCTGCTGTCCACCCAGCGCTCCATCGCCTTCCTGGCCTGTGCCAGTCAGATGTTCTTCTCCTTCAGCTTTGGCTTCACCCACTCCTTCCTGCTCACCGTCATGGGCTACGACCGCTACGTGGCCATCTGCCACCCCCTGCGCTACAACGTGCTCATGAGCCCACGGGGCTGCGCCTGCCTGGTGGGCTGCTCCTGGGCTGGTGGCTCGGTCATGGGGATGGTGGTGACCTCGGCCATTTTCCAACTGACTTTCTGTGGATCCCATGAGATCCAGCATTTTTTATGTCATGTGCCACCTCTGTTGAAGTTGGCCTGTGGAAATAATGTACCAGCTGTGGCCCTGGGCGTGGGCTTGGTATGTATCATGGCACTGCTGGGCTGTTTTCTCCTCATCCTCCTCTCCTATGCCTTCATCGTGGCCGACATCTTGAAGATCCCTTCTGCTGAAGGTCGGAACAAGGCCTTCTCCACCTGTGCCTCTCACCTTATTGTGGTCATTGTGCACTATGGCTTTGCCTCTGTCATCTACCTCAAGCCCAAAGGTCCCCACTCTCAGGAGGGTGACACCCTGATGGCCACCACCTACGCAGTCCTCACGCCCTTCCTCAGCCCCATCATCTTCAGCCTCAGGAACAAAGAACTGAAGGTTGCCATGAAGAGGACCTTCCTCAGCACACTCTATTCCTCAGGCACCTGA

Length: 948

View AllClose

0 Reviews

View AllClose