Human OPTN cDNA Clone BC032762 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016363HU2
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPTN
Gene ID:
10133
Accession #:
BC032762
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human OPTN cDNA Clone BC032762 pENTR223.1 Plasmid | Cusabio

Gene Name: OPTN

Gene ID: 10133

Accession Number: BC032762

Vector: pENTR223.1

Sequence: ATGTCCCATCAACCTCTCAGCTGCCTCACTGAAAAGGAGGACAGCCCCAGTGAAAGCACAGGAAATGGACCCCCCCACCTGGCCCACCCAAACCTGGACACGTTTACCCCGGAGGAGCTGCTGCAGCAGATGAAAGAGCTCCTGACCGAGAACCACCAGCTGAAAGAAGCCATGAAGCTAAATAATCAAGCCATGAAAGGGAGATTTGAGGAGCTTTCGGCCTGGACAGAGAAACAGAAGGAAGAACGCCAGTTTTTTGAGATACAGAGCAAAGAAGCAAAAGAGCGTCTAATGGCCTTGAGTCATGAGAATGAGAAATTGAAGGAAGAGCTTGGAAAACTAAAAGGGAAATCAGAAAGGTCATCTGAGGACCCCACTGATGACTCCAGGCTTCCCAGGGCCGAAGCGGAGCAGGAAAAGGACCAGCTCAGGACCCAGGTGGTGAGGCTACAAGCAGAGAAGGCAGACCTGTTGGGCATCGTGTCTGAACTGCAGCTCAAGCTGAACTCCAGCGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTGACATCTCTGTTTAAGGAGCTTCAAGAGGCTCATACAAAACTCAGCGAAGCTGAGCTAATGAAGAAGAGACTTCAAGAAAAGTGTCAGGCCCTTGAAAGGAAAAATTCTGCAATTCCATCAGAGTTGAATGAAAAGCAAGAGCTTGTTTATACTAACAAAAAGTTAGAGCTACAAGTGGAAAGCATGCTATCAGAAATCAAAATGGAACAGGCTAAAACAGAGGATGAAAAGTCCAAATTAACTGTGCTACAGATGACACACAACAAGCTTCTTCAAGAACATAATAATGCATTGAAAACAATTGAGGAACTAACAAGAAAAGAGTCAGAAAAAGTGGACAGGGCAGTGCTGAAGGAACTGAGTGAAAAACTGGAACTGGCAGAGAAGGCTCTGGCTTCCAAACAGCTGCAAATGGATGAAATGAAGCAAACCATTGCCAAGCAGGAAGAGGACCTGGAAACCATGACCATCCTCAGGGCTCAGATGGAAGTTTACTGTTCTGATTTTCATGCTGAAAGAGCAGCGAGAGAGAAAATTCATGAGGAAAAGGAGCAACTGGCATTGCAGCTGGCAGTTCTGCTGAAAGAGAATGATGCTTTCGAAGACGGAGGCAGGCAGTCCTTGATGGAGATGCAGAGTCGTCATGGGGCGAGAACAAGTGACTCTGACCAGCAGGCTTACCTTGTTCAAAGAGGAGCTGAGGACAGGGACTGGCGGCAACAGCGGAATATTCCGATTCATTCCTGCCCCAAGTGTGGAGAGGTTCTGCCTGACATAGACACGTTACAGATTCACGTGATGGATTGCATCATTTAA

Length: 1716

View AllClose

0 Reviews

View AllClose