Human OPN5 cDNA Clone BC126194 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL740895HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPN5
Gene ID:
221391
Accession #:
BC126194
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human OPN5 cDNA Clone BC126194 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OPN5

Gene ID: 221391

Accession Number: BC126194

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGTTAAATCACACTGCCCTGCCTCAGGACGAGCGCCTGCCCCATTACCTTCGAGATGGGGATCCTTTTGCTTCCAAACTTTCTTGGGAAGCGGATTTAGTGGCTGGCTTTTACCTAACAATAATTGGGATTCTGTCCACATTTGGAAATGGATATGTCCTTTACATGTCTTCTAGACGAAAGAAGAAGCTGAGACCCGCTGAAATAATGACTATCAATTTAGCAGTCTGTGATCTGGGGATTTCAGTTGTAGGCAAGCCGTTCACCATCATCTCTTGCTTTTGTCACCGCTGGGTGTTTGGCTGGATCGGCTGCCGCTGGTATGGATGGGCTGGATTTTTCTTTGGCTGTGGAAGCCTTATCACCATGACTGCTGTCAGCCTGGATCGATATTTGAAAATCTGCTATTTATCTTATGGGGTTTGGCTGAAAAGAAAGCACGCCTACATCTGCCTGGCAGCCATCTGGGCCTATGCTTCCTTCTGGACCACCATGCCCTTGGTAGGTCTGGGGGACTACGTACCTGAGCCCTTCGGAACCTCGTGCACCCTGGACTGGTGGCTGGCCCAGGCCTCGGTAGGGGGCCAGGTTTTCATCCTGAACATCCTCTTCTTCTGCCTCTTGCTCCCAACGGCTGTGATCGTGTTCTCCTACGTAAAGATCATTGCCAAGGTTAAGTCCTCTTCCAAAGAAGTAGCTCATTTCGACAGTCGGATCCATAGCAGCCATGTGCTGGAAATGAAACTGACAAAGGTAGCGATGTTGATTTGTGCTGGATTCCTGATTGCCTGGATTCCTTATGCAGTGGTGTCTGTGTGGTCAGCTTTTGGAAGGCCAGACTCCATTCCCATACAGCTCTCTGTGGTGCCAACCCTACTTGCAAAATCTGCAGCGATGTACAATCCCATCATTTACCAAGTTATTGATTACAAATTTGCCTGTTGCCAAACTGGTGGTTTGAAAGCAACCAAGAAGAAGTCTCTGGAAGGCTTCAGGCTGCACACCGTAACCACAGTCAGGAAGTCTTCTGCTGTGCTGGAAATTCATGAAGAGTGGGAATAA

Length: 1065

View AllClose

0 Reviews

View AllClose