Human OPN4 cDNA Clone BC113558 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL883398HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPN4
Gene ID:
94233
Accession #:
BC113558
Plasmid:
pUC
€473.00
Frequently bought together:

Description

Human OPN4 cDNA Clone BC113558 pUC Plasmid | Cusabio

Gene Name: OPN4

Gene ID: 94233

Accession Number: BC113558

Vector: pUC

Sequence: ATGAACCCTCCTTCGGGGCCAAGAGTCCTGCCCAGCCCAACCCAAGAGCCCAGCTGCATGGCCACCCCAGCACCACCCAGCTGGTGGGACAGCTCCCAGAGCAGCATCTCCAGCCTGGGCCGGCTTCCATCCATCAGTCCCACAGCACCTGGGACTTGGGCTGCTGCCTGGGTCCCCCTCCCCACGGTTGATGTTCCAGACCATGCCCACTATACCCTGGGCACAGTGATCTTGCTGGTGGGACTCACGGGGATGCTGGGCAACCTGACGGTCATCTATACCTTCTGCAGGAGCAGAAGCCTCCGGACACCTGCCAACATGTTCATTATCAACCTCGCGGTCAGCGACTTCCTCATGTCCTTCACCCAGGCCCCTGTCTTCTTCACCAGTAGCCTCTATAAGCAGTGGCTCTTTGGGGAGACAGGCTGCGAGTTCTATGCCTTCTGTGGAGCTCTCTTTGGCATTTCCTCCATGATCACCCTGACGGCCATCGCCCTGGACCGCTACCTGGTAATCACACGCCCGCTGGCCACCTTTGGTGTGGCGTCCAAGAGGCGTGCGGCATTTGTCCTGCTGGGCGTTTGGCTCTATGCCCTGGCCTGGAGTCTGCCACCCTTCTTCGGCTGGAGCGCCTACGTGCCCGAGGGGTTGCTGACATCCTGCTCCTGGGACTACATGAGCTTCACGCCGGCCGTGCGTGCCTACACCATGCTTCTCTGCTGCTTCGTGTTCTTCCTCCCTCTGCTTATCATCATCTACTGCTACATCTTCATCTTCAGGGCCATCCGGGAGACAGGACGGGCTCTCCAGACCTTCGGGGCCTGCAAGGGCAATGGCGAGTCCCTGTGGCAGCGGCAGCGGCTGCAGAGCGAGTGCAAGATGGCCAAGATCATGCTGCTGGTCATCCTCCTCTTCGTGCTCTCCTGGGCTCCCTATTCCGCTGTGGCCCTGGTGGCCTTTGCTGGGTACGCACACGTCCTGACACCCTACATGAGCTCGGTGCCAGCCGTCATCGCCAAGGCCTCTGCAATCCACAACCCCATCATTTACGCCATCACCCACCCCAAGTACAGGGTGGCCATTGCCCAGCACCTGCCCTGCCTGGGGGTGCTGCTGGGTGTATCACGCCGGCACAGTCGCCCCTACCCCAGCTACCGCTCCACCCACCGCTCCACGCTGACCAGCCACACCTCCAACCTCAGCTGGATCTCCATACGGAGGCGCCAGGAGTCCCTGGGCTCGGAGAGTGAGGTGGGCTGGACACACATGGAGGCAGCAGCTGTGTGGGGAGCTGCCCAGCAAGCAAATGGGCGGTCCCTCTACGGTCAGGGTCTGGAGGACTTGGAAGCCAAGGCACCCCCCAGACCCCAGGGACACGAAGCAGAGACTCCAGGGAAGACCAAGGGGCTGATCCCCAGCCAGGACCCCAGGATGTAG

Length: 1437

View AllClose

0 Reviews

View AllClose