Human OPN3 cDNA Clone BC036773 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL872435HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPN3
Gene ID:
23596
Accession #:
BC036773
Plasmid:
pUC
€414.00
Frequently bought together:

Description

Human OPN3 cDNA Clone BC036773 pUC Plasmid | Cusabio

Gene Name: OPN3

Gene ID: 23596

Accession Number: BC036773

Vector: pUC

Sequence: ATGTACTCGGGGAACCGCAGCGGCGGCCACGGCTACTGGGACGGCGGCGGGGCCGCGGGCGCTGAGGGGCCGGCGCCGGCGGGGACACTGAGCCCCGCGCCCCTCTTCAGCCCCGGCACCTACGAGCGCCTGGCGCTGCTGCTGGGCTCCATTGGGCTGCTGGGCGTCGGCAACAACCTGCTGGTGCTCGTCCTCTACTACAAGTTCCAGCGGCTCCGCACTCCCACTCACCTCCTCCTGGTCAACATCAGCCTCAGCGACCTGCTGGTGTCCCTCTTCGGGGTCACCTTTACCTTCGTGTCCTGCCTGAGGAACGGCTGGGTGTGGGACACCGTGGGCTGCGTGTGGGACGGGTTTAGCGGCAGCCTCTTCGGGATTGTTTCCATTGCCACCCTAACCGTGCTGGCCTATGAACGTTACATTCGCGTGGTCCATGCCAGAGTGATCAATTTTTCCTGGGCCTGGAGGGCCATTACCTACATCTGGCTCTACTCACTGGCGTGGGCAGGAGCACCTCTCCTGGGATGGAACAGGTACATCCTGGACGTACACGGACTAGGCTGCACTGTGGACTGGAAATCCAAGGATGCCAACGATTCCTCCTTTGTGCTTTTCTTATTTCTTGGCTGCCTGGTGGTGCCCCTGGGTGTCATAGCCCATTGCTATGGCCATATTCTATATTCCATTCGAATGCTTCGTTGTGTGGAAGATCTTCAGACAATTCAAGTGATCAAGATTTTAAAATATGAAAAGAAACTGGCCAAAATGTGCTTTTTAATGATATTCACCTTCCTGGTCTGTTGGATGCCTTATATCGTGATCTGCTTCTTGGTGGTTAATGGTCATGGTCACCTGGTCACTCCAACAATATCTATTGTTTCGTACCTCTTTGCTAAATCGAACACTGTATACAATCCAGTGATTTATGTCTTCATGATCAGAAAGTTTCGAAGATCCCTTTTGCAGCTTCTGTGCCTCCGACTGCTGAGGTGCCAGAGGCCTGCTAAAGACCTACCAGCAGCTGGAAGTGAAATGCAGATCAGACCCATTGTGATGTCACAGAAAGATGGGGACAGGCCAAAGAAAAAAGTGACTTTCAACTCTTCTTCCATCATTTTTATCATCACCAGTGATGAATCACTGTCAGTTGACGACAGCGACAAAACCAATGGGTCCAAAGTTGATGTAATCCAAGTTCGTCCTTTGTAG

Length: 1209

View AllClose

0 Reviews

View AllClose