Human OPHN1 cDNA Clone BC059393 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016348HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPHN1
Gene ID:
4983
Accession #:
BC059393
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human OPHN1 cDNA Clone BC059393 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OPHN1

Gene ID: 4983

Accession Number: BC059393

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGTCATCCCCCGCTGGAGTTCAGCGACTGCTACCTGGACAGCCCCGATTTCCGCGAGAGGCTCAAGTGTTATGAGCAGGAACTGGAGAGGACCAACAAATTCATCAAAGACGTAATCAAAGACGGCAACGCGCTTATCAGCGCTATGAGAAATTATTCTTCTGCTGTTCAGAAATTTTCCCAGACGCTGCAGTCATTTCAGTTTGATTTCATTGGAGACACTCTGACTGATGATGAAATTAACATCGCTGAATCCTTCAAGGAATTTGCTGAATTGCTCAACGAGGTAGAAAATGAGAGGATGATGATGGTACACAATGCTAGTGATTTGCTGATTAAACCCTTGGAAAATTTCCGGAAGGAACAAATAGGCTTCACCAAGGAGCGGAAAAAGAAATTTGAAAAGGATGGTGAGAGGTTTTATTCTTTACTGGATCGGCACTTACACCTGTCTTCAAAAAAGAAAGAATCTCAGTTACAAGAGGCAGACCTACAGGTGGACAAGGAGAGGCACAATTTTTTCGAGTCCTCTCTTGATTATGTTTATCAAATCCAGGAAGTTCAGGAGTCCAAGAAGTTCAATATTGTGGAGCCTGTCTTGGCCTTTCTTCATAGTCTGTTCATTTCTAACAGCCTGACTGTGGAGCTCACACAGGATTTCCTCCCATACAAACAACAGCTCCAACTCAGTTTACAGAATACAAGAAATCATTTCTCCAGTACCCGGGAAGAGATGGAAGAACTTAAGAAAAGGATGAAAGAAGCTCCCCAGACATGCAAACTTCCAGGACAGCCAACTATTGAAGGCTATCTCTATACACAAGAGAAATGTGTGTGGGGACATAGGGGTATCCATTGGGTTTCAATAAGCCAGGAACTACTGCCACTTGTCGGCTGTGAATTTTGGGCACCCTTACTGTTCATAGACCCCTGA

Length: 936

View AllClose

0 Reviews

View AllClose