Human OPCML cDNA Clone BC117254 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL621799HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPCML
Gene ID:
4978
Accession #:
BC117254
Plasmid:
pUC
€370.00
Frequently bought together:

Description

Human OPCML cDNA Clone BC117254 pUC Plasmid | Cusabio

Gene Name: OPCML

Gene ID: 4978

Accession Number: BC117254

Vector: pUC

Sequence: ATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCTCAGGCTGCTGTTCCTTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACGGTCCGGCAGGGGGAGAGCGCCACCCTCAGGTGTACCATAGATGACCGGGTAACCCGGGTGGCCTGGCTAAACCGCAGCACCATCCTCTACGCTGGGAATGACAAGTGGTCCATAGACCCTCGTGTGATCATCCTGGTCAATACACCAACCCAGTACAGCATCATGATCCAAAATGTGGATGTGTATGACGAAGGTCCGTACACCTGCTCTGTGCAGACAGACAATCATCCCAAAACGTCCCGGGTTCACCTAATAGTGCAAGTTCCTCCTCAGATCATGAATATCTCCTCAGACATCACTGTGAATGAGGGAAGCAGTGTGACCCTGCTGTGTCTTGCTATTGGCAGACCAGAGCCAACTGTGACATGGAGACACCTGTCAGTCAAGGAAGGCCAGGGCTTTGTAAGTGAGGATGAGTACCTGGAGATCTCTGACATCAAGCGAGACCAGTCCGGGGAGTACGAATGCAGCGCGTTGAACGATGTCGCTGCGCCCGATGTGCGGAAAGTAAAAATCACTGTAAACTATCCTCCCTATATCTCAAAAGCCAAGAACACTGGTGTTTCAGTCGGTCAGAAGGGCATCCTGAGCTGTGAAGCCTCTGCAGTCCCCATGGCTGAATTCCAGTGGTTCAAGGAAGAAACCAGGTTAGCCACTGGTCTGGATGGAATGAGGATTGAAAACAAAGGCCGCATGTCCACTCTGACTTTCTTCAATGTTTCAGAAAAGGATTATGGGAACTATACTTGTGTGGCCACGAACAAGCTTGGGAACACCAATGCCAGCATCACATTGTATGGGCCTGGAGCAGTCATTGATGGTGTAAACTCGGCCTCCAGAGCACTGGCTTGTCTCTGGCTATCAGGGACCCTCTTAGCCCACTTCTTCATCAAGTTTTGA

Length: 1038

View AllClose

0 Reviews

View AllClose