Human OPALIN cDNA Clone BC033737 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822279HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPALIN
Gene ID:
93377
Accession #:
BC033737
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OPALIN cDNA Clone BC033737 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OPALIN

Gene ID: 93377

Accession Number: BC033737

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTTTTTCACTGAACTTCACCCTGCCGGCGAACACAACGTCCTCTCCTGTCACAGGTGGGAAAGAAACGGACTGTGGGCCCTCTCTTGGATTAGCGGCGGGCATACCATTGCTGGTGGCCACAGCCCTGCTGGTGGCTTTACTATTTACTTTGATTCACCGAAGAAGAAGCAGCATTGAGGCCATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCCAAGATATCTGAGAATCCTAGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCACATATATGTGAAGACTGTAGCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATGGAAAGAAGGAGGGGATTGTGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA

Length: 426

View AllClose

0 Reviews

View AllClose