Human OPA3 cDNA Clone BC005059 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL880985HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OPA3
Gene ID:
80207
Accession #:
BC005059
Plasmid:
pUC
€240.00
Frequently bought together:

Description

Human OPA3 cDNA Clone BC005059 pUC Plasmid | Cusabio

Gene Name: OPA3

Gene ID: 80207

Accession Number: BC005059

Vector: pUC

Sequence: ATGGTGGTGGGCGCGTTCCCTATGGCGAAGCTGCTATACTTGGGCATCCGGCAGGTCAGCAAGCCGCTTGCCAACCGTATTAAGGAGGCCGCCCGCCGAAGCGAGTTCTTCAAGACCTATATCTGCCTCCCGCCGGCTCAACTGTATCACTGGGTGGAGATGCGGACCAAGATGCGCATCATGGGCTTCCGGGGCACGGTCATCAAGCCGCTGAACGAGGAGGCGGCAGCCGAGCTGGGCGCAGAGCTGCTGGGCGAAGCCACCATCTTCATCGTGGGCGGCGGCTGCCTAGTGCTGGAGTACTGGCGCCACCAGGCGCAGCAGCGCCACAAGGAGGAGGAGCAGCGTGCTGCCTGGAACGCGCTGCGGGACGAGGTGGGCCACCTGGCGCTGGCGCTGGAAGCGCTGCAGGCGCAGGTGCAGGCGGCGCCGCCACAGGGCGCCCTGGAGGAACTGCGCACAGAGCTGCAAGAGGTGCGCGCCCAGCTCTGCAATCCCGGCCGGTCCGCTTCCCACGCAGTGCCTGCGTCCAAGAAATAG

Length: 540

View AllClose

0 Reviews

View AllClose