Human ONECUT2 cDNA Clone BC108925 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016337HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ONECUT2
Gene ID:
9480
Accession #:
BC108925
Plasmid:
pUC
€412.00
Frequently bought together:

Description

Human ONECUT2 cDNA Clone BC108925 pUC Plasmid | Cusabio

Gene Name: ONECUT2

Gene ID: 9480

Accession Number: BC108925

Vector: pUC

Sequence: ATGGTCACCAGCATGGCCTCGATCCTGGACGGCGGCGACTACCGGCCCGAGCTCTCCATCCCGCTGCACCACGCCATGAGCATGTCCTGCGACTCGTCTCCGCCTGGCATGGGCATGAGCAACACCTACACCACGCTGACACCGCTCCAGCCGCTGCCACCCATCTCCACCGTGTCTGACAAGTTCCACCACCCTCACCCGCACCACCATCCGCACCACCACCACCACCACCACCACCAGCGCCTGTCCGGCAACGTCAGCGGCAGCTTCACCCTCATGCGCGACGAGCGCGGGCTCCCGGCCATGAACAACCTCTACAGTCCCTACAAGGAGATGCCCGGCATGAGCCAGAGCCTGTCCCCGCTGGCCGCCACGCCGCTGGGCAACGGGCTAGGCGGCCTCCACAACGCGCAGCAGAGTCTGCCCAACTACGGTCCGCCGGGCCACGACAAAATGCTCAGCCCCAACTTCGACGCGCACCACACTGCCATGCTGACCCGCGGTGAGCAACACCTGTCCCGCGGCCTGGGCACCCCACCTGCGGCCATGATGTCGCACCTGAACGGCCTGCACCACCCGGGCCACACTCAGTCTCACGGGCCGGTGCTGGCACCCAGTCGCGAGCGGCCACCCTCGTCCTCATCGGGCTCGCAGGTGGCCACGTCGGGCCAGCTGGAAGAAATCAACACCAAAGAGGTGGCCCAGCGCATCACAGCGGAGCTGAAGCGCTACAGTATCCCCCAGGCGATCTTTGCGCAGAGGGTGCTGTGCCGGTCTCAGGGGACTCTCTCCGACCTGCTCCGGAATCCAAAACCGTGGAGTAAACTCAAATCTGGCAGGGAGACCTTCCGCAGGATGTGGAAGTGGCTTCAGGAGCCCGAGTTCCAGCGCATGTCCGCCTTACGCCTGGCAGCGTGCAAACGCAAAGAGCAAGAACCAAACAAAGACAGGAACAATTCCCAGAAGAAGTCCCGCCTGGTGTTCACTGACCTCCAACGCCGAACACTCTTCGCCATCTTCAAGGAGAACAAACGCCCGTCAAAGGAGATGCAGATCACCATTTCCCAGCAGCTGGGCCTGGAGCTCACAACCGTCAGCAACTTCTTCATGAACGCCCGGCGCCGCAGCCTGGAGAAGTGGCAAGACGATCTGAGCACAGGGGGCTCCTCGTCCACCTCCAGCACGTGTACCAAAGCATGA

Length: 1200

View AllClose

0 Reviews

View AllClose