null

Human OMG cDNA Clone BC018050 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016334HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OMG
Gene ID:
4974
Accession #:
BC018050
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OMG cDNA Clone BC018050 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OMG

Gene ID: 4974

Accession Number: BC018050

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAATATCAGATATTGAAAATGTCTCTCTGCCTGTTCATCCTTCTGTTTCTCACACCTGGTATTTTATGCATTTGTCCTCTCCAATGTATATGCACAGAGAGGCACAGGCATGTGGACTGTTCAGGCAGAAACTTGTCTACATTACCATCTGGACTGCAAGAGAATATTATACATTTAAACCTGTCTTATAACCACTTTACTGATCTGCATAACCAGTTAACCCAATATACCAATCTGAGGACCCTGGACATTTCAAACAACAGGCTTGAAAGCCTGCCTGCTCACTTACCTCGGTCTCTGTGGAACATGTCTGCTGCTAACAACAACATTAAACTTCTTGACAAATCTGATACTGCTTATCAGTGGAATCTTAAATATCTGGATGTTTCTAAGAACATGCTGGAAAAGGTTGTCCTCATTAAAAATACACTAAGAAGTCTCGAGGTTCTCAACCTCAGTAGTAACAAACTTTGGACAGTTCCAACCAACATGCCCTCCAAACTACATATCGTGGACCTGTCTAATAATTCTTTGACACAAATTCTTCCAGGTACATTAATAAACCTGACAAATCTCACACATCTTTACCTGCACAACAATAAGTTCACATTCATTCCAGACCAATCTTTTGACCAACTCTTTCAGTTGCAAGAGATAACCCTTTACAATAACAGGTGGTCATGTGACCACAAACAAAACATTACTTACTTACTGAAGTGGATGATGGAAACAAAAGCCCATGTGATAGGGACTCCATGTTCTACCCAAATATCATCTTTAAAGGAACATAACATGTATCCCACACCTTCTGGATTTACCTCAAGCTTATTCACTGTAAGTGGGATGCAGACAGTGGACACCATTAACTCTCTGAGTGTGGTAACTCAACCCAAAGTGACCAAAATACCCAAACAATATCGAACAAAGGAAACAACGTTTGGTGCCACTCTAAGCAAAGACACCACCTTTACTAGCACTGATAAGGCTTTTGTGCCCTATCCAGAAGATACATCCACAGAGACTATCAATTCACATGAAGCAGCAGCTGCAACTCTAACTATTCATCTCCAAGATGGAATGGTCACAAACACAAGCCTCACTAGCTCAACAAAATCATCCCCAACACCCATGACCCTAAGTATCACTAGTGGCATGCCAAATAATTTCTCTGAAATGCCTCAACAAAGCACAACCCTTAACTTATGGAGGGAAGAGACAACCACAAATGTAAAGACTCCATTACCTTCTGTGGCAAATGCTTGGAAAGTAAATGCTTCATTTCTCTTATTGCTCAATGTTGTGGTCATGCTGGCTGTCTGA

Length: 1323

View AllClose

0 Reviews

View AllClose