Human OLR1 cDNA Clone BC022295 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016331HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLR1
Gene ID:
4973
Accession #:
BC022295
Plasmid:
pUC
€313.00
Frequently bought together:

Description

Human OLR1 cDNA Clone BC022295 pUC Plasmid | Cusabio

Gene Name: OLR1

Gene ID: 4973

Accession Number: BC022295

Vector: pUC

Sequence: ATGACTTTTGATGACCTAAAGATCCAGACTGTGAAGGACCAGCCTGATGAGAAGTCAAATGGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCGACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTATCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAACTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAACGAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAAATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGTTCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCGGGCTCATTTAACTGGGAAAAGAGCCAAGAGAAGTGCTTGTCTTTGGATGCCAAGTTGCTGAAAATTAATAGCACAGCTGATCTGGACTTCATCCAGCAAGCAATTTCCTATTCCAGTTTTCCATTCTGGATGGGGCTGTCTCGGAGGAACCCCAGCTACCCATGGCTCTGGGAGGACGGTTCTCCTTTGATGCCCCACTTATTTAGAGTCCGAGGCGCTGTCTCCCAGACATACCCTTCAGGTACCTGTGCATATATACAACGAGGAGCTGTTTATGCGGAAAACTGCATTTTAGCTGCCTTCAGTATATGTCAGAAGAAGGCAAACCTAAGAGCACAGTGA

Length: 822

View AllClose

0 Reviews

View AllClose