null

Human OLIG3 cDNA Clone BC051352 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016330HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLIG3
Gene ID:
167826
Accession #:
BC051352
Plasmid:
pUC
€313.00
Frequently bought together:

Description

Human OLIG3 cDNA Clone BC051352 pUC Plasmid | Cusabio

Gene Name: OLIG3

Gene ID: 167826

Accession Number: BC051352

Vector: pUC

Sequence: ATGAATTCTGATTCGAGCTCTGTCTCCAGCAGAGCTTCATCTCCGGACATGGATGAGATGTACCTGAGGGACCACCACCACCGCCACCACCACCACCAGGAGAGCCGTCTCAACTCGGTCTCGTCCACGCAGGGCGATATGATGCAGAAGATGCCCGGGGAAAGCCTCTCGCGGGCTGGCGCCAAGGCCGCGGGAGAGAGCAGCAAGTACAAAATCAAGAAGCAGCTGTCGGAGCAGGACCTACAGCAGTTGAGGCTGAAGATCAACGGACGCGAACGCAAGCGGATGCACGACCTGAACCTAGCCATGGACGGGCTGCGCGAAGTCATGCCCTACGCGCATGGGCCGTCGGTGCGCAAGCTCTCCAAGATCGCCACACTCCTGCTCGCCAGAAACTACATCCTCATGCTCACCAGCTCCCTGGAGGAGATGAAGAGGCTGGTTGGCGAGATCTATGGGGGCCACCACTCGGCCTTTCACTGCGGGACCGTGGGCCACTCGGCCGGCCACCCCGCGCACGCGGCCAACTCCGTGCACCCGGTGCACCCCATCTTGGGCGGCGCGCTCTCATCTGGCAACGCCTCGTCACCGCTGTCCGCCGCCTCACTTCCCGCCATCGGCACCATCCGGCCTCCCCACTCGCTACTCAAGGCGCCCTCCACGCCGCCCGCGCTGCAGCTGGGCAGCGGCTTCCAGCACTGGGCTGGTCTGCCCTGCCCCTGCACCATCTGCCAGATGCCGCCGCCGCCGCACCTGTCCGCTCTCTCCACAGCCAACATGGCCCGGCTGTCGGCCGAGTCCAAGGACTTGCTCAAGTGA

Length: 819

View AllClose

0 Reviews

View AllClose