Human OLFML2B cDNA Clone BC067274 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL734650HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLFML2B
Gene ID:
25903
Accession #:
BC067274
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human OLFML2B cDNA Clone BC067274 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OLFML2B

Gene ID: 25903

Accession Number: BC067274

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCAAGCCTCGGCTGCTAGTTCTCTACTTCGCTCTGATTGTGGTTCCGGCCTGGGTGTCCAGCATTGTCCTCACAGGGACAAGCGAGCCCCCAGATGCGCAGACAGTGGCGCCTGCGGAGGACGAGACTCTGCAAAACGAGGCGGACAACCAGGAGAACGTTTTATCTCAGTTGCTGGGGGACTATGACAAGGTCAAGGCTATGTCTGAGGGCTCGGACTGTCAGTGCAAGTGTGTGGTGAGACCCCTGGGCCGGGATGCCTGCCAGAGGATCAATGCGGGGGCCTCCAGGAAGGAAGACTTCTATACCGTGGAAACCATCACCTCAGGCTCGTCGTGCAAGTGTGCCTGTGTAGCACCCCCATCGGCCCTCAATCCCTGCGAGGGAGACTTCAGGCTCCAGAAGCTGCGGGAGGCAGACAGCCAGGACTTGAAGCTCTCCACAATCATAGACATGTTGGAAGGAGCGTTCTATGGCCTGGATCTCCTGAAGCTACATTCAGTCACCACCAAACTGGTGGGGCGAGTGGATAAACTGGAGGAGGAAGTGTCTAAAAACCTCACCAAGGAAAACGAACAAATCAAAGAGGACATGGAAGAAATTCGAACCGAGATGAATAAGCGAGGCAAAGAAAATTGCTCTGAAAACATCCTAGATAGCATGCCAGACATCCGCTCAGCCCTGCAGAGGGATGCAGCAGCAGCCTACGCCCACCCAGAGTATGAAGAGCGGTTTCTGCAGGAAGAAACCGTGTCCCAGCAGATCAACTCCATCGAACTTCTGCAGACGCGACCCCTGGCTCTGCCTGAGGTGGTGAAGTCACAGCGGCCCCTGCAGAGGCAGGTCCACCTGAGAGGCCGGCCGGCCTCCCAGCCCACTGTCATCCGGGGCATCACCTACTATAAAGCCAAGGTCTCTGAAGAAGAGAATGACATTGAAGAGCAGCAAGATGAGTTTTTCAGCGGTGACAATGGAGTGGATTTGCTGATTGAAGATCAGCTCCTGAGACACAACGGCCTGATGACCAGTGTCACCCGGAGGCCTGCAGCCACCCGTCAGGGACACAGCACTGCTGTGACAAGCGACCTGAACGCTCGGACCGCACCCTGGTCCTCAGCACTGCCACAGCCCTCGACCTCAGATCCCAGCATCGCCAACCATGCCTCAGTGGGACCAACACTCCAAACAACCTCGGTGTCTCCAGATCCCACAAGGGAGTCAGTCCTGCAGCCTTCTCCTCAGGTACCAGCCACCACTGTGGCCCACACAGCCACCCAGCAACCAGCAGCCCCAGCTCCTCCGGCAGTGTCTCCCAGGGAGGCATTGATGGAAGCTATGCACACAGTCCCAGTGCCTCCCACCACAGTCAGAACAGACTCGCTGGGGAAAGATGCTCCTGCTGGGTGGGGAACAACCCCTGCCAGCCCCACGCTGAGCCCCGAAGAAGAAGATGACATCCGGAATGTCATAGGAAGGTGCAAGGACACTCTCTCCACAATCACGGGGCCGACCACCCAGAACACATATGGGCGGAATGAAGGGGCCTGGATGAAGGACCCCCTGGCCAAGGATGAGCGGATTTACGTAACCAACTATTACTACGGCAACACCCTGGTAGAGTTCCGGAACCTGGAGAACTTCAAACAAGGTCGCTGGAGCAATTCCTACAAGCTCCCGTACAGCTGGATCGGCACAGGCCACGTGGTATACAATGGCGCCTTCTACTACAATCGCGCCTTCACCCGCAACATCATCAAGTACGACCTGAAGCAGCGCTACGTGGCTGCCTGGGCCATGCTGCATGACGTGGCCTACGAGGAGGCCACCCCCTGGCGATGGCAGGGCCACTCAGACGTGGACTTTGCTGTGGACGAGAATGGCCTATGGCTCATCTACCCGGCCCTGGACGATGAGGGCTTCAGCCAGGAGGTCATTGTCCTGAGCAAGCTCAATGCCGCGGACCTGAGCACACAGAAGGAGACCACATGGCGCACGGGGCTCCGGAGGAATTTCTACGGCAACTGCTTCGTCATCTGTGGGGTGCTGTATGCCGTGGATAGCTACAACCAGCGGAATGCCAACATCTCCTACGCTTTCGACACCCACACCAACACACAGATCGTCCCCAGGCTGCTGTTCGAGAATGAGTATTCCTATACGACCCAGATAGACTACAACCCCAAGGACCGCCTGCTCTATGCCTGGGACAATGGCCACCAGGTCACTTACCATGTCATCTTTGCCTACTGA

Length: 2253

View AllClose

0 Reviews

View AllClose