Human OIP5 cDNA Clone BC015050 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016316HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OIP5
Gene ID:
11339
Accession #:
BC015050
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OIP5 cDNA Clone BC015050 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OIP5

Gene ID: 11339

Accession Number: BC015050

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCTCAGCCGCTGCGGCATCGCTCACGTTGTGCAACGCCGCCCCGGGGGGACTTTTGTGGTGGCACTGAGAGGGCGATTGACCAAGCTTCTTTTACGACCTCCATGGAGTGGGATACGCAGGTGGTGAAGGGGTCCTCGCCGCTCGGCCCCGCAGGGCTGGGGGCTGAGGAGCCAGCCGCCGGCCCGCAGCTGCCGTCTTGGCTGCAGCCTGAGAGGTGCGCTGTGTTCCAGTGCGCACAGTGTCACGCAGTGCTCGCCGACTCGGTGCACCTCGCCTGGGACCTGTCGCGGTCCCTCGGGGCCGTGGTCTTCTCCAGAGTTACAAATAACGTCGTTTTGGAAGCGCCCTTCCTAGTTGGCATTGAAGGTTCACTCAAAGGCAGTACTTACAACCTTTTATTCTGTGGTTCTTGTGGGATTCCCGTTGGTTTCCATCTGTATTCTACCCATGCTGCCCTGGCTGCCTTGAGAGGTCACTTCTGCCTTTCCAGTGACAAAATGGTGTGCTATCTCTTAAAAACAAAAGCCATAGTAAATGCATCAGAGATGGATATTCAAAATGTTCCTCTATCAGAAAAGATTGCAGAGCTGAAAGAGAAGATAGTGCTAACGCACAATCGCTTAAAATCACTAATGAAGATTCTGAGTGAAGTGACTCCTGACCAGTCCAAGCCAGAAAACTGA

Length: 690

View AllClose

0 Reviews

View AllClose