Human OGT cDNA Clone BC014434 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016315HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGT
Gene ID:
8473
Accession #:
BC014434
Plasmid:
pUC
€1,033.00
Frequently bought together:

Description

Human OGT cDNA Clone BC014434 pUC Plasmid | Cusabio

Gene Name: OGT

Gene ID: 8473

Accession Number: BC014434

Vector: pUC

Sequence: ATGGCGTCTTCCGTGGGCAACGTGGCCGACAGCACAGGGTTAGCTGAGTTGGCACATCGAGAATATCAGGCAGGAGATTTTGAGGCAGCTGAGAGACACTGCATGCAGCTCTGGAGACAAGAGCCAGACAATACTGGTGTGCTTTTATTACTTTCATCTATACACTTCCAGTGTCGAAGGCTGGACAGATCTGCTCACTTTAGCACTCTGGCAATTAAACAGAACCCCCTTCTGGCAGAAGCTTATTCGAATTTGGGGAATGTGTACAAGGAAAGAGGGCAGTTGCAGGAGGCAATTGAGCATTATCGACATGCATTGCGTCTCAAACCTGATTTCATCGATGGTTATATTAACCTGGCAGCCGCCTTGGTAGCAGCGGGTGACATGGAAGGGGCAGTACAAGCTTACGTCTCTGCTCTTCAGTACAATCCTGATTTGTACTGTGTTCGCAGTGACCTGGGGAACCTGCTCAAAGCCCTGGGTCGCTTGGAAGAAGCCAAGGCATGTTATTTGAAAGCAATTGAGACGCAACCGAACTTTGCAGTAGCTTGGAGTAATCTTGGCTGTGTTTTCAATGCACAAGGGGAAATTTGGCTTGCAATTCATCACTTTGAAAAGGCTGTCACCCTTGACCCAAACTTTCTGGATGCTTATATCAATTTAGGAAATGTCTTGAAAGAGGCACGCATTTTTGACAGAGCTGTGGCAGCTTATCTTCGTGCCCTAAGTTTGAGTCCAAATCACGCAGTGGTGCACGGCAACCTGGCTTGTGTATACTATGAGCAAGGCCTGATAGATCTGGCAATAGACACCTACAGGCGGGCTATCGAACTACAACCACATTTCCCTGATGCTTACTGCAACCTAGCCAATGCTCTCAAAGAGAAGGGCAGTGTTGCTGAAGCAGAAGATTGTTATAATACAGCTCTCCGTCTGTGTCCCACCCATGCAGACTCTCTGAATAACCTAGCCAATATCAAACGAGAACAGGGAAACATTGAAGAGGCAGTTCGCTTGTATCGTAAAGCATTAGAAGTCTTCCCAGAGTTTGCTGCTGCCCATTCAAATTTAGCAAGTGTACTGCAGCAGCAGGGAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCATAGTATGCTATATCCTCTTTCTCATGGCTTCAGGAAGGCTATTGCTGAGAGGCACGGCAACCTGTGCTTAGATAAGATTAATGTTCTTCATAAACCACCATATGAACATCCAAAAGACTTGAAGCTCAGTGATGGTCGGCTGCGTGTAGGATATGTGAGTTCCGACTTTGGGAATCATCCTACTTCTCACCTTATGCAGTCTATTCCAGGCATGCACAATCCTGATAAATTTGAGGTGTTCTGTTATGCCCTGAGCCCAGACGATGGCACAAACTTCCGAGTGAAGGTGATGGCAGAAGCCAATCATTTCATTGATCTTTCTCAGATTCCATGCAATGGAAAAGCAGCTGATCGCATCCATCAGGATGGAATTCATATCCTTGTAAATATGAATGGCTATACTAAGGGCGCTCGAAATGAGCTTTTTGCTCTCAGGCCAGCTCCTATTCAGGCAATGTGGCTGGGATACCCTGGGACGAGTGGTGCGCTTTTCATGGATTATATTATCACTGATCAGGAAACTTCGCCAGCTGAAGTTGCTGAGCAGTATTCCGAGAAATTGGCTTATATGCCCCACACTTTTTTTATTGGTGATCATGCTAATATGTTCCCTCACCTGAAGAAAAAAGCAGTCATCGATTTTAAGTCCAATGGGCACATTTATGACAATCGGATAGTTCTGAATGGCATCGACCTCAAAGCATTTCTTGATAGTCTACCAGATGTGAAAATTGTCAAGATGAAGTGTCCTGATGGAGGAGACAATGCAGATAGCAGTAACACAGCTCTTAATATGCCTGTTATTCCTATGAATACTATTGCAGAAGCAGTTATTGAAATGATTAACCGAGGACAGATTCAAATAACAATTAATGGATTCAGTATTAGCAATGGACTGGCAACTACTCAGATCAACAATAAGGCTGCAACTGGAGAGGAGGTTCCCCGTACCATTATTGTAACCACCCGTTCTCAGTACGGGTTACCAGAAGATGCCATCGTATACTGTAACTTTAATCAGTTGTATAAAATTGACCCTTCTACTTTGCAGATGTGGGCAAACATTCTGAAGCGTGTTCCCAATAGTGTACTCTGGCTGTTGCGTTTTCCAGCAGTAGGAGAACCTAATATTCAACAGTATGCACAAAACATGGGCCTGCCCCAGAACCGTATCATTTTTTCACCTGTTGCTCCTAAAGAGGAACACGTCAGGAGAGGCCAGCTGGCTGATGTCTGCTTGGACACTCCACTCTGTAATGGGCACACCACAGGGATGGATGTCCTCTGGGCAGGGACCCCCATGGTGACTATGCCAGGAGAGACTCTTGCTTCTCGAGTTGCAGCATCCCAGCTCACTTGCTTAGGTTGTCTTGAGCTTATTGCTAAAAACAGACAAGAATATGAAGACATAGCTGTGAAGCTGGGAACTGATCTAGAATACCTGAAGAAAGTTCGTGGCAAAGTCTGGAAGCAAAGAATATCTAGCCCTCTGTTCAACACCAAACAATACACAATGGAACTAGAGCGGCTCTATCTACAGATGTGGGAGCATTATGCAGCTGGCAACAAACCTGACCACATGATTAAGCCTGTTGAAGTCACTGAGTCAGCATAA

Length: 3111

View AllClose

0 Reviews

View AllClose