Human OGG1 cDNA Clone BC000657 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016313HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGG1
Gene ID:
4968
Accession #:
BC000657
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OGG1 cDNA Clone BC000657 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OGG1

Gene ID: 4968

Accession Number: BC000657

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCTGGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGATCAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGAGACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTCCAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTCCAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGCCTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGGCTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTCCCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTGGGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGCGGGCTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTCTGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGACAAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGCTGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGAAACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGCTGTTCAGTGCCGACCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGGGCCGGAAGGCTAG

Length: 1038

View AllClose

0 Reviews

View AllClose