Human OGFOD2 cDNA Clone BC098293 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL754021HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGFOD2
Gene ID:
79676
Accession #:
BC098293
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OGFOD2 cDNA Clone BC098293 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OGFOD2

Gene ID: 79676

Accession Number: BC098293

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCTAAGGGGAGGCCCAACACCATGAACAACTACGGGGTGCTGCTGCACGAGCTCGGGCTGGACGAGCCGCTGATGACACCACTGCGGGAGCGCTTCCTGCAGCCGCTGATGGCCCTGCTGTACCCTGACTGTGGCGGGGGCCGGCTCGACAGCCACCGGGCCTTTGTGGTCAAATACGCACCGGGCCAGGACCTGGAGCTGGGCTGCCACTATGATAATGCCGAGCTCACCCTCAATGTGGCCTTGGGCAAGGTCTTCACAGGGGGCGCCCTGTATTTTGGGGGCCTCTTCCAGGCACCCACAGCCCTGACGGAGCCCCTGGAGGTGGAGCACGTGGTGGGCCAGGGTGTCCTCCACCGTGGCGGCCAGCTGCATGGAGCCCGGCCCTTGGGCACTGGTGAGCGTTGGAACCTTGTCGTCTGGCTCCGAGCCTCTGCTGTGCGCAACAGCCTCTGTCCCATGTGCTGCCGTGAGCCCGACCTGGTGGACGATGAGGGCTTCGGTGATGGCTTCACCCGAGAGGAGCCCGCCACGGTGGATGTATGTGCGCTCACCTGA

Length: 561

View AllClose

0 Reviews

View AllClose