null

Human OGDHL cDNA Clone BC026320 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL892464HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGDHL
Gene ID:
55753
Accession #:
BC026320
Plasmid:
pUC
$1,245.60
Frequently bought together:

Description

Human OGDHL cDNA Clone BC026320 pUC Plasmid | Cusabio

Gene Name: OGDHL

Gene ID: 55753

Accession Number: BC026320

Vector: pUC

Sequence: ATGAGTCAGCTGAGGCTGCTGCCGTCCCGTCTTGGGGTGCAGGCTGCGAGGCTCCTGGCTGCACATGACGTCCCGGTGTTTGGCTGGCGCAGCAGGTCCTCCGGGCCACCGGCCACCTTCCCAAGCAGCAAAGGTGGAGGCGGCTCCAGTTACATGGAGGAGATGTACTTCGCCTGGTTGGAAAACCCCCAGAGTGTCCACAAGTCCTGGGACAGCTTCTTCAGGGAAGCCAGCGAGGAAGCCTTTTCTGGCTCTGCTCAGCCACGGCCCCCTTCTGTTGTCCATGAGAGCAGGTCTGCAGTCTCAAGTCGGACCAAGACCAGCAAATTGGTGGAGGACCACCTGGCTGTGCAGTCCCTGATCCGGGCCTACCAGATCCGGGGTCACCATGTGGCCCAGCTGGACCCCCTGGGCATTCTGGATGCAGACCTGGACTCCTTTGTGCCCTCAGACTTGATCACAACCATTGATAAACTGGCCTTCTATGACCTTCAGGAGGCTGACCTTGATAAGGAGTTCCAGCTGCCGACAACCACCTTCATTGGGGGCTCTGAAAACACCCTTTCTCTGCGGGAGATCATTCGGCGCCTGGAGAACACCTACTGCCAGCACATTGGCCTGGAGTTCATGTTCATCAACGATGTGGAGCAGTGCCAGTGGATCCGGCAGAAGTTTGAGACCCCTGGTGTGATGCAGTTCTCCAGCGAGGAGAAGCGGACCCTGCTGGCCCGGCTAGTGCGCTCCATGAGGTTTGAAGACTTCCTGGCCCGGAAATGGTCCTCAGAGAAGCGGTTTGGCCTGGAGGGCTGTGAAGTGATGATTCCTGCCCTCAAGACCATCATCGACAAATCCAGCGAGATGGGGATTGAGAATGTCATCTTGGGGATGCCACACAGGGGAAGGCTGAACGTGCTGGCCAACGTGATCCGCAAGGACCTGGAGCAGATCTTCTGCCAGTTTGACCCCAAGCTGGAGGCGGCGGACGAGGGCTCCGGGGATGTCAAGTACCACCTGGGCATGTACCATGAGAGGATCAACCGCGTCACCAACCGGAACATCACTCTGTCGCTGGTTGCCAACCCCTCCCACCTGGAGGCAGTGGACCCTGTGGTGCAGGGGAAGACAAAGGCAGAGCAGTTCTACCGTGGAGATGCCCAGGGCAAGAAGGTCATGTCCATCCTGGTTCATGGGGACGCCGCCTTTGCTGGCCAGGGCGTGGTATATGAGACCTTCCACCTGAGCGACCTGCCCTCCTACACGACCAATGGTACCGTGCACGTCGTCGTCAACAACCAGATTGGATTCACCACAGACCCCCGAATGGCCCGCTCCTCACCATACCCGACCGACGTGGCCCGGGTGGTCAATGCGCCTATCTTCCATGTGAATGCAGATGACCCAGAGGCTGTGATATATGTGTGCAGTGTGGCAGCCGAATGGAGAAACACTTTCAACAAAGATGTTGTCGTGGACCTGGTCTGTTACCGCCGGCGTGGCCACAATGAGATGGACGAGCCCATGTTCACCCAGCTGCTCATGTACAAGCAGATCCACAGACAGGTGCCTGTGCTGAAGAAGTACGCAGACAAGCTGATTGCCGAGGGCACAGTCACCCTGCAGGAGTTTGAGGAAGAAATTGCCAAATACGACCGGATCTGTGAGGAGGCTTATGGCAGGTCCAAGGATAAAAAGATTCTGCATATAAAGCACTGGTTGAACTCCCCCTGGCCTGGCTTCTTCAACGTAGATGGGGAGCCCAAGAGCATGACATGCCCAGCCACGGGGATCCCTGAGGACATGCTCACCCACATCGGCAGTGTGGCCAGCTCTGTGCCCCTGGAGGACTTTAAGATCCACACTGGCCTCTCTCGCATTCTGCGGGGCCGTGCGGACATGACCAAGAACCGGACGGTGGACTGGGCGTTGGCAGAGTACATGGCCTTTGGCTCCCTGCTGAAGGAAGGCATCCACGTGCGGCTCAGCGGGCAGGATGTGGAGAGGGGCACATTCAGTCACCGGCACCATGTTCTCCATGACCAGGAGGTTGACCGCAGGACGTGTGTGCCTATGAATCATCTCTGGCCTGACCAGGCCCCGTACACCGTGTGCAACAGCTCCCTCTCGGAGTACGGAGTCCTGGGCTTTGAGCTGGGCTATGCCATGGCCAGCCCCAATGCCCTGGTCCTCTGGGAGGCCCAGTTTGGGGACTTCCACAACACGGCCCAGTGCATCATCGACCAGTTCATCAGCACCGGCCAGGCCAAGTGGGTGCGGCATAATGGCATTGTGCTGCTGCTGCCCCATGGCATGGAAGGCATGGGCCCAGAGCACTCGTCAGCGAGGCCCGAAAGGTTCCTGCAGATGAGCAATGATGACTCGGATGCCTACCCTGCATTCACCAAGGACTTCGAGGTGAGCCAGCTCTATGACTGCAACTGGATCGTGGTCAACTGCTCCACACCGGCCAACTACTTCCACGTGCTGCGCCGGCAGATCCTGCTGCCCTTCCGCAAGCCGCTGATTATCTTCACACCTAAATCTCTGCTGAGGCACCCAGAGGCCAAGTCCAGCTTTGACCAAATGGTATCCGGGACCAGCTTCCAGCGGGTGATTCCTGAAGATGGGGCCGCAGCACGGGCCCCTGAGCAGGTGCAGCGGCTCATCTTCTGCACGGGAAAGGTGTACTATGACCTGGTGAAGGAGCGGAGCAGCCAGGACCTGGAGGAGAAAGTGGCCATCACGCGCCTGGAGCAGATCTCTCCATTCCCCTTCGACCTGATCAAGCAGGAGGCAGAGAAGTACCCAGGTGCGGAGCTGGCCTGGTGTCAGGAGGAGCACAAGAACATGGGCTACTATGACTACATCAGCCCACGCTTCATGACCATCCTGAGGCGCGCACGGCCCATATGGTATGTTGGCCGGGACCCAGCGGCTGCACCAGCCACAGGAAACAGGAACACTCACCTGGTGTCACTGAAGAAGTTTCTGGATACTGCCTTCAATCTCCAGGCCTTTGAGGGCAAGACATTTTAG

Length: 3033

View AllClose

0 Reviews

View AllClose