null

Human OFD1 cDNA Clone BC096344 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016289HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OFD1
Gene ID:
8481
Accession #:
BC096344
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€516.00
Frequently bought together:

Description

Human OFD1 cDNA Clone BC096344 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OFD1

Gene ID: 8481

Accession Number: BC096344

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATGGCGCAGTCCAACATGTTTACCGTGGCTGATGTGTTGAGTCAAGATGAACTGCGCAAAAAGCTATACCAGACGTTTAAGGATCGGGGTATACTGGATACACTCAAGACACAACTTCGAAACCAGCTAATTCATGAGTTGATGCACCCTGTATTGAGTGGAGAACTGCAGCCTCGGTCCATTTCAGTAGAAGGGAGCTCCCTCTTAATAGGCGCCTCTAACTCTTTAGTGGCAGATCACTTACAAAGATGTGGCTATGAATATTCACTTTCTGTTTTCTTTCCAGAAAGTGGTTTGGCAAAAGAAAAGGTATTTACTATGCAGGATCTATTACAACTCATTAAAATCAACCCTACTTCCAGTCTCTACAAATCACTGGTTTCAGGATCTGATAAAGAAAATCAAAAAGGTTTTCTTATGCATTTTTTAAAAGAATTGGCAGAATATCATCAAGCTAAAGAGAGTTGTAATATGGAAACTCAGACAAGTTCGACATTTAACAGAGATTCTCTGGCTGAGAAGCTTCAGCTTATTGATGATCAGTTTGCAGATGCTTACCCTCAGCGTATCAAGTTCGAATCTTTAGAAATAAAGCTAAATGAGTATAAGAGAGAAATAGAAGAGCAACTTCGGGCAGAAATGTGTCAAAAGTTGAAGTTTTTTAAAGATACCGAGATAGCAAAAATTAAAATGGAAGCAAAAAAAAAGTATGAAAAGGAGTTAACCATGTTCCAGAATGATTTTGAAAAAGCTTGTCAAGCAAAATCTGAAGCTCTCGTTCTTCGGGAAAAGAGTACCCTTGAAAGAATTCACAAGCACCAAGAGATTGAAACAAAAGAAATTTATGCTCAAAGGCAACTTTTACTAAAAGATATGGATTTGCTAAGAGGAAGAGAAGCAGAGCTGAAGCAAAGAGTTGAAGCTTTTGAATTGTATCAACTTGAACTGAAGGATGACTACATCATTAGAACTAATCGACTGATTGAAGATGAAAGGAAGAATAAAGAAAAAGCTGTTCATTTGCAAGAGGAGCTCATAGCTATTAATTCAAAAAAGGAGGAACTCAATCAATCTGTAAATCGTGTGAAAGAACTTGAGCTTGAATTAGAGTCTGTCAAAGCCCAGTCTTTGGCAATAACAAAACAAAACCATATGCTGAATGAAAAGGTTAAAGAGATGAGTGATTATTCACTACTAAAAGAAGAGAAACTGGAGCTTCTGGCACAAAATAAATTACTTAAACAACAACTGGAAGAGAGTAGAAATGAAAACCTGCGTCTCCTAAACCGCCTAGCTCAGCCGGCTCCTGAACTTGCAGTCTTTCAGAAAGAACTACGGAAAGCCGAAAAGGCTATAGTGGTTGAGCATGAGGAGTTCGAAAGCTGCAGGCAAGCTCTGCACAAACAACTGCAAGACGAAATTGAGCATTCTGCACAGCTGAAGGCCCAGATTCTAGGTTACAAAGCTTCTGTAAAGAGTTTAACTACTCAGGTTGCCGATTTAAAATTGCAACTGAAGCAAACTCAGACAGCCCTAGAGAATGAAGTGTACTGCAATCCAAAGCAGTCTGTGATCGATCGTTCTGTCAATGGATTAATAAATGGCAATGTGGTGCCTTGCAATGGTGAGATAAGTGGGGATTTCTTGAACAATCCTTTTAAACAGGAAAACGTTCTAGCACGTATGGTTGCATCAAGGATCACAAATTATCCAACTGCATGGGTGGAGGGTAGTTCCCCTGATTCTGACCTTGAGTTTGTAGCCAATACTAAGGCAAGGGTCAAAGAGCTTCAGCAAGAGGCCGAACGCTTGGAAAAGGCTTTCAGAAGTTACCATCGGAGAGTCATTAAAAACTCTGCCAAAAGCCCACTAGCAGCAAAGAGCCCACCATCTCTGCACTTGCTGGAAGCCTTCAAAAACATTACTTCCAGTTCCCCGGAAAGACATATTTTTGGAGAGGACAGAGTTGTCTCTGAGCAGCCTCAAGTGGGCACACTTGAAGAAAGGAATGACGTCGTGGAAGCACTGACAGGCAGTGCAGCCTCGAGGCTCCGCGGGGGCACTTCCTCCAGACGCCTCTCTTCCACACCCCTTCCAAAAGCAAAAAGAAGCCTCGAAAGTGAAATGTATCTGGAAGGTCTGGGCAGATCACACATTGCTTCCCCCAGTCCTTGTCCTGACAGAATGCCCCTACCATCACCCACTGAGTCTAGGCACAGCCTCTCCATCCCTCCTGTCTCCAGCCCTCCGGAGCAGAAAGTGGGTCTTTATCGAAGACAAACTGAACTTCAAGACAAAAGTGAATTTTCAGATGTGGACAAGCTAGCTTTTAAGGATAATGAGGAGTTTGAATCATCTTTTGAATCTGCAGGGAACATGCCAAGGCAGTTGGAAATGGGCGGGCTTTCTCCTGCCGGGGATATGTCTCATGTGGACGCTGCTGCAGCTGCTGTGCCCCTCTCATATCAGCACCCAAGTGTAGATCAGAAACAAATTGAAGAACAAAAGGAAGAAGAAAAAATACGGGAACAGCAAGTGAAAGAACGAAGGCAGAGAGAAGAAAGAAGGCAGAGTAACCTACAAGAAGTTTTAGAAAGGGAACGAAGAGAACTAGAAAAACTGTATCAGGAAAGGAAGATGATTGAAGAATCACTGAAGATTAAAATAAAAAAGGAATTAGAAATGGAAAATGAATTAGAAATGAGTAATCAAGAAATAAAAGACAAATCTGCTCACAGTGAAAATCCTTTAGAGAAATACATGAAAATCATCCAGCAGGAGCAAGACCAGGAGTCGGCAGATAAGAGCTCAAAAAAGATGGTCCAAGAAGGCTCCCTAGTGGACACGCTGCAATCTAGTGACAAAGTCGAAAGTTTAACAGGCTTTTCTCATGAAGAACTAGACGACTCTTGGTAA

Length: 2919

View AllClose

0 Reviews

View AllClose