null

Human OFCC1 cDNA Clone BC113541 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL809031HU
Availability:
Inquiry
€214.00
Frequently bought together:

Description

Human OFCC1 cDNA Clone BC113541 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OFCC1

Gene ID: 266553

Accession Number: BC113541

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGAGAGAGAAGTTTCAGCAGAAGGCTCTGAAGCAAACTAAGCAGAAGAAATCCAAGTCGGCTGAATTTCTGATGGTTAAAGAAGATAGAGAAGCTACAGAAGGCACTGGAAATCCAGCTTTTAACATGAGCAGTCCAGATCTCTCAGCATGTCAGACTGCAGAAAAGAAAGTTATTAGACACGACATGCCGGATCGCACCCTTGCAGCTCACCAACAAAAATTCAGGCTGCCAGCCTCTGCAGAACCAAAAGGAAATGAATACGGCAGAAATTACTTTGACCCACTGATGGATGAGGAAATAAACCCAAGGCAGTGTGCGACGGAGGTCAGCAGAGAAGATGACGATAGAATTTTCTATAATCGATTAACGAAGCTTTTTGATGAGAGCAGACAAGGAGAACCCCAAGATGAGAGTGGCCGGGAGGAGACTCTGAATTCTGAAGCACCTGGGAGTTCCAATAAGAGTCACGAAATCCACAAAGAAGCCAGCGAAGCCACCACTGCTCACCTTGAGGAGTTCCAAAGATCTCAGAAAACTATAATTCTGCTTGGAAGTTCTCCATTAGAACAGGAAATTAGATCTACTTCATTGCATTGTATGGAGGATGAGATGAGTCATCCATGGATACTCTTGCTCAAAGTAACTGCTGTAATCAGAAGCAGGAGGTACTATAGAGAGCAAAGATTCTAA

Length: 696

View AllClose

0 Reviews

View AllClose