Human ODF3L2 cDNA Clone BC104469 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL662244HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF3L2
Gene ID:
284451
Accession #:
BC104469
Plasmid:
pUC
€326.00
Frequently bought together:

Description

Human ODF3L2 cDNA Clone BC104469 pUC Plasmid | Cusabio

Gene Name: ODF3L2

Gene ID: 284451

Accession Number: BC104469

Vector: pUC

Sequence: ATGGGGACCCTCAGCTGCGACTCCACCCCACGGCTGGCCACAGCCCCCCTTGGCCGGCGAGTGACGGAGGGCCAGATTCCGGAGACCGGCCTGAGGAAGTCCTGTGGGACGGCCACCCTGGAGAACGGCTCGGGGCCAGGCTTGTATGTCCTGCCGTCCACCGTGGGCTTCATCAACCACGACTGCACCAGGGTGGCCAGTCCCGCCTACTCGCTCGTCCGGAGGCCCAGTGAGGCACCACCTCAGGACACCAGCCCGGGCCCCATCTACTTCTTGGACCCCAAAGTCACACGCTTTGGCCGCAGCTGCACCCCTGCCTACTCCATGCAGGGCCGGGCCAAGTCTCGGGGTCCGGAGGTGACGCCAGGCCCTGGGGCCTACAGCCCAGAGAAGGTGCCCCCTGCGCGCCATCGGACACCGCCGGCTTTCACCCTGGGCTGCCGCCTCCCCCTGAAGCCCCTGGACACCTCAGCCCCTGCCCCTAATGCCTACACCATGCCCCCTCTGTGGGGCTCACAGATCTTCACCAAGCCCAGCAGCCCCAGCTACACGGTGGTGGGCCGCACCCCCCCCGCCCGCCCCCCGCAGGATCCTGCTGAGATACCAGGCCCGGGCCAGTACGACAGCCCGGACGCAAACACCTACCGCCAGCGCCTGCCTGCCTTCACCATGCTGGGGCGGCCCCGGGCCCCGCGACCCCTGGAGGAGACCCCCGGCCCTGGCGCCCACTGCCCAGAGCAGGTCACCGTGAACAAAGCCAGGGCTCCAGCGTTCTCTATGGGCATCCGCCACTCGAAACGGGCCAGCACCATGGCCGCCACCACGCCCTCCCGGCCTGCGGGGCACAGGCTGCCCGGCCGCTGCTGCTAG

Length: 870

View AllClose

0 Reviews

View AllClose