Human ODF3L1 cDNA Clone BC039862 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL814225HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF3L1
Gene ID:
161753
Accession #:
BC039862
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human ODF3L1 cDNA Clone BC039862 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ODF3L1

Gene ID: 161753

Accession Number: BC039862

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAACTGCCCAAGGGGACCAGGAGCTCTGTGTACTTTGCACAGCACCCAGAAAAGGAGCCATTGCCCTCAAGGCAGGAGGTCAAGCAGACCCCTGTCATCATGGCCAAGATCAAAGGTCCGGGGCCCGCCAAGTACCTCCGGCCATCCTGCACGGGCTACATAGATCATGACATCTCCATGTTCAAGGCACCAGCTTATACCCTGCATAGCCGGCACTCAGAGAAGCGGATGGTGTGCCACAGCAGCCCTGGGCCTTGCTATCTCTTGGATCCCAAAATAACTCGGTTTGGAATGTCCAGCTGCCCGCAGGTCCCCATGGAGGAGCGCATCTCCAACCTGCGCCTGAACCCCACCCTCGCATCCTGCCAGTACTACTTTGAGAAGATCCACCCACCGGGGGAACGCAGGGCTCCCCAGTACACGTTTGGCTACCGGCGCCCATACAGAGTGATGGACCTCAACCCGGCTCCCAACCAGTACCAGATGCCACTCTTGCTGGGGCCCAACACCCCTGTCAGCCGAGCTGCTCCCTGCTACAGTCTGGCCTCCAGGGACAAGAACTGGTTCTACAAGGAGGATGTGGCAGGAGGCCCTGGACCTACCACGTACGCCCGACCTGAGCCATCCATCTATCAGAACCGCAGCCCTACTTACAGCATGGCCAAGCGCTTCGCCTACCCTCTGGACCTCACGCCACGGCCTGGCCCCGGCTCCCACGAGGTCCAGCAGGTCACTGTGCACAAGCCCCACATCCCTGCTTTCACCATGGGCATCAAGCACTCACTCCACCTGTGCCCACTGGTCATCGACATTCGTGACTGA

Length: 825

View AllClose

0 Reviews

View AllClose