Human ODF2L cDNA Clone BC009779 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL891737HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF2L
Gene ID:
57489
Accession #:
BC009779
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ODF2L cDNA Clone BC009779 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ODF2L

Gene ID: 57489

Accession Number: BC009779

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTGCTAGAAAATCTAACTGATAATGAAAGTGAAAATACTAATCTTAAGAAGAAGGTATTTGAAAAGGAGGCCCATATCCAAGAACTTTCTTGTTTGTTTCAGAGTGAAAAGAGCTTAGAAACCAAGATAGCCAAGTGGAACCTGCAATCAAGAATGAATAAGAATGAGGCTATAGTGATGAAAGAAGCAAGTAGGCAAAAAACTGTAGCTTTAAAAAAAGGCATCTAA

Length: 231

View AllClose

0 Reviews

View AllClose