Cusabio Customized Plasmid
Human ODF2L cDNA Clone BC009779 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL891737HU
- UPC:
- MPN:
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ODF2L
- Gene ID:
- 57489
- Accession #:
- BC009779
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
MSRP:
Now:
€214.00
Was:
— You save
Description
Human ODF2L cDNA Clone BC009779 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: ODF2L
Gene ID: 57489
Accession Number: BC009779
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTTGCTAGAAAATCTAACTGATAATGAAAGTGAAAATACTAATCTTAAGAAGAAGGTATTTGAAAAGGAGGCCCATATCCAAGAACTTTCTTGTTTGTTTCAGAGTGAAAAGAGCTTAGAAACCAAGATAGCCAAGTGGAACCTGCAATCAAGAATGAATAAGAATGAGGCTATAGTGATGAAAGAAGCAAGTAGGCAAAAAACTGTAGCTTTAAAAAAAGGCATCTAA
Length: 231
Related Products
![Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23654/31623/cusabio__81676.1638370075__39651.1639271536.jpg?c=1)
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23498/31467/cusabio__81676.1638370075__62668.1639271473.jpg?c=1)
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€438.00
Was:
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23543/31512/cusabio__81676.1638370075__39243.1639271491.jpg?c=1)
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23612/31581/cusabio__81676.1638370075__29113.1639271519.jpg?c=1)
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM161BGene ID: 153396Accession Number: BC037287Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM161B
- Gene ID:
- 153396
- Accession #:
- BC037287
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23679/31648/cusabio__81676.1638370075__02630.1639271546.jpg?c=1)
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM39AGene ID: 55254Accession Number: BC003192Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023834HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM39A
- Gene ID:
- 55254
- Accession #:
- BC003192
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23710/31679/cusabio__81676.1638370075__05076.1639271559.jpg?c=1)
Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€438.00
Was:
Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM63AGene ID: 9725Accession Number: BC030245Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023865HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM63A
- Gene ID:
- 9725
- Accession #:
- BC030245
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23786/31755/cusabio__81676.1638370075__98858.1639271589.jpg?c=1)
Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid | CusabioGene Name: TNFRSF14Gene ID: 8764Accession Number: BC002794Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL842173HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TNFRSF14
- Gene ID:
- 8764
- Accession #:
- BC002794
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23740/31709/cusabio__81676.1638370075__55622.1639271571.jpg?c=1)
Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMIGD2Gene ID: 126259Accession Number: BC015655Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL850263HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMIGD2
- Gene ID:
- 126259
- Accession #:
- BC015655
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human TOR1A cDNA Clone BC000674 pENTR223.1 or pUC Plasmid Human TOR1A cDNA Clone BC000674 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/23843/31812/cusabio__81676.1638370075__47453.1639271612.jpg?c=1)
Human TOR1A cDNA Clone BC000674 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human TOR1A cDNA Clone BC000674 pENTR223.1 or pUC Plasmid | CusabioGene Name: TOR1AGene ID: 1861Accession Number: BC000674Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL024067HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TOR1A
- Gene ID:
- 1861
- Accession #:
- BC000674
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC