null

Human ODF2 cDNA Clone BC010629 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL691501HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF2
Gene ID:
4957
Accession #:
BC010629
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human ODF2 cDNA Clone BC010629 pENTR223.1 Plasmid | Cusabio

Gene Name: ODF2

Gene ID: 4957

Accession Number: BC010629

Vector: pENTR223.1

Sequence: ATGAAAGGGGACACTGTGAATGTGCGGCGGAGTGTCCGGGTGAAAACCAAGAATCCACCTCATTGCCTGGAGATCACGCCACCATCTTCAGAAAAGCTGGTCTCAGTGATGCGGTTAAGTGACCTCTCTACAGAAGATGATGACTCAGGTCACTGTAAAATGAACCGTTATGATAAGAAGATTGATAGTCTAATGAATGCGGTTGGTTGTCTGAAGTCTGAGGTCAAGATGCAAAAAGGTGAGCGCCAGATGGCCAAAAGGTTCCTGGAGGAACGGAAGGAAGAGCTGGAGGAGGTGGCCCACGAACTGGCTGAGACTGAGCACGAGAACACGGTGTTGAGGCACAACATCGAGCGCATGAAGGAGGAGAAGGACTTCACCATACTTCAGAAGAAACACCTACAACAGGAGAAGGAGTGCCTCATGTCCAAGCTGGTGGAGGCGGAAATGGATGGGGCTGCGGCTGCCAAGCAGGTCATGGCCTTGAAGGATACCATCGGGAAGCTGAAAACGGAGAAACAAATGACCTGCACGGACATCAACACCCTGACAAGGCAGAAGGAACTTCTCCTGCAGAAGCTGAGCACATTTGAGGAGACCAACCGCACCCTCCGAGACCTCCTGAGGGAACAGCACTGCAAAGAGGATTCTGAAAGACTAATGGAGCAACAAGGAGCACTGCTGAAACGGCTGGCGGAGGCCGACTCAGAGAAAGCGCGCCTGCTGTTACTGCTGCAAGACAAGGACAAGGAGGTGGAAGAGCTCCTTCAGGAAATACAATGTGAGAAGGCTCAAGCAAAGACAGCCTCTGAGCTTTCTAAATCCATGGAGTCCATGCGTGGGCATTTGCAGGCACAGCTTCGGTCCAAAGAGGCTGAGAACAGTCGCCTGTGCATGCAGATTAAGAATCTGGAGCGCAGCGGGAATCAGCATAAGGCAGAAGTGGAGGCCATCATGGAGCAGCTGAAGGAGTTGAAGCAGAAGGGAGACCGAGACAAAGAGAGCTTGAAGAAGGCCATCCGAGCCCAGAAGGAGCGAGCCGAGAAGAGCGAGGAGTATGCTGAGCAGCTACACGTGCAACTCGCTGACAAGGATCTTTATGTCGCTGAAGCTTTATCCACTCTGGAATCCTGGAGGAGCCGCTACAACCAAGTTGTAAAAGAAAAGGGAGACCTTGAGCTGGAAATTATTGTCCTGAATGACCGGGTAACAGATCTTGTAAACCAACAACAAACCCTGGAGGAGAAGATGCGGGAAGACCGGGATAGCCTGGTGGAGAGACTACACCGTCAGACTGCTGAGTATTCCGCATTCAAGCTGGAGAATGAGAGGCTGAAGGCCAGCTTTGCTCCAATGGAGGACAAACTCAACCAGGCACACCTCGAGGTCCAGCAGCTGAAGGCCTCAGTGAAGAACTATGAGGGGATGATTGACAACTATAAGAGTCAGGTGATGAAGACCAGATTGGAGGCTGATGAAGTAGCTGCCCAGCTAGAACGCTGTGACAAAGAGAACAAGATCCTTAAAGATGAGATGAACAAAGAGATTGAGGCGGCACGAAGGCAGTTCCAGTCTCAGCTGGCTGACCTGCAGCAGCTCCCTGACATCCTGAAGATCACGGAGGCGAAGCTGGCTGAGTGCCAAGACCAACTGCAGGGCTATGAGCGGAAGAACATCGACCTCACAGCCATCATATCAGACCTGCGCAGCCGGATCGAACACCAGGGGGACAAGCTGGAGATGGCGAGAGAGAAACATCAGGCTTCCCAGAAGGAAAATAAACAGCTGAGTCTGAAGGTGGATGAACTGGAGAGGAAACTGGAGGCGACCAGTGCCCAGAATATCGAGTTCCTACAGGTGATTGCCAAGAGGGAGGAGGCAATCCACCAGTCCCAGCTGCGGCTGGAGGAGAAAACACGGGAATGTGGGACCCTGGCAAGGCAGTTGGAGAGTGCCATTGAAGATGCGAGGAGGCAGGTGGAACAAACCAAGGAGCACGCACTCTCCAAGGAGCGAGCAGCCCAGAACAAAATCCTGGACCTTGAGACCCAGCTGAGCAGAACCAAAACGGAATTGAGCCAGCTGCGGCGGAGCCGTGATGATGCGGACCGCCGCTACCAGAGCCGGCTGCAAGACCTGAAAGATCGCCTGGAGCAGTCCGAGAGCACCAACCGCAGCATGCAGAACTACGTCCAGTTCCTCAAATCATCATACGCCAACGTGTTTGGGGATGGTCCCTATTCCACCTTCCTGACTAGCTCTCCCATCCGCTCCCGATCTCCTCCTGCCTGA

Length: 2292

View AllClose

0 Reviews

View AllClose