null

Human ODF1 cDNA Clone BC104457 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613531HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ODF1
Gene ID:
4956
Accession #:
BC104457
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human ODF1 cDNA Clone BC104457 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ODF1

Gene ID: 4956

Accession Number: BC104457

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGCACTGAGTTGTCTCTTGGACAGTGTCAGAAGGGACATAAAGAAGGTGGACAGAGAACTAAGGCAACTGAGATGCATCGACGAATTTAGCACACGGTGCCTGTGCGACTTGTATATGCACCCCTATTGCTGCTGTGACTTGCACCCATATCCGTACTGCTTGTGCTATTCCAAGCGATCACGCTCTTGCGGCCTGTGTGATCTCTACCCATGTTGCCTGTGTGATTATAAGCTTTACTGTCTGCGACCATCTCTCAGAAGTTTGGAGAGGAAAGCCATCAGAGCCATAGAAGATGAGAAGCGAGAGCTTGCCAAACTGAGAAGAACAACAAATAGAATTCTGGCTTCCTCCTGCTGTAGCAGTAACATTTTAGGATCGGTGAATGTATGCGGTTTTGAACCCGATCAAGTCAAAGTTCGAGTGAAGGATGGAAAGGTATGTGTGTCGGCTGAGCGGGAGAACAGGTACGACTGCCTTGGATCGAAAAAGTACAGCTACATGAACATCTGCAAAGAGTTCAGCTTGCCGCCCTGTGTGGATGAGAAGGATGTAACATACTCCTATGGGCTCGGCAGCTGTGTCAAGATCGAGTCTCCTTGCTACCCTTGCACTTCTCCTTGCAGCCCGTGCAGCCCGTGCAACCCCTGCAACCCCTGCAGCCCCTGCAACCCGTGCAGCCCATATGATCCTTGCAACCCGTGTTATCCCTGTGGAAGCCGATTTTCCTGTAGGAAGATGATTTTGTAA

Length: 753

View AllClose

0 Reviews

View AllClose