null

Human OCM cDNA Clone BC069468 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL317613HU
Availability:
Inquiry
€214.00
Frequently bought together:

Description

Human OCM cDNA Clone BC069468 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OCM

Gene ID: 654231

Accession Number: BC069468

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCATCACGGACGTGCTCAGTGCTGACGACATTGCAGCAGCGCTCCAGGAATGCCGAGACCCAGACACTTTTGAACCCCAAAAATTCTTCCAGACATCAGGCCTCTCCAAGATGTCAGCCAATCAGGTGAAGGATGTTTTCCGGTTCATAGACAACGACCAGAGCGGGTACCTGGATGAAGAAGAGCTTAAGTTTTTCCTCCAGAAGTTTGAGAGTGGTGCCAGAGAACTGACCGAGTCAGAAACCAAGTCCTTGATGGCTGCGGCGGATAATGATGGAGATGGGAAAATTGGAGCAGAGGAATTCCAGGAAATGGTGCATTCTTAA

Length: 330

View AllClose

0 Reviews

View AllClose