Human OCLN cDNA Clone BC029886 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016263HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OCLN
Gene ID:
4950
Accession #:
BC029886
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human OCLN cDNA Clone BC029886 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OCLN

Gene ID: 4950

Accession Number: BC029886

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCATCCAGGCCTCTTGAAAGTCCACCTCCTTACAGGCCTGATGAATTCAAACCGAATCATTATGCACCAAGCAATGACATATATGGTGGAGAGATGCATGTTCGACCAATGCTCTCTCAGCCAGCCTACTCTTTTTACCCAGAAGATGAAATTCTTCACTTCTACAAATGGACCTCTCCTCCAGGAGTGATTCGGATCCTGTCTATGCTCATTATTGTGATGTGCATTGCCATCTTTGCCTGTGTGGCCTCCACGCTTGCCTGGGACAGAGGCTATGGAACTTCCCTTTTAGGAGGTAGTGTAGGCTACCCTTATGGAGGAAGTGGCTTTGGTAGCTACGGAAGTGGCTATGGCTATGGCTATGGTTATGGCTATGGCTACGGAGGCTATACAGACCCAAGAGCAGCAAAGGGCTTCATGTTGGCCATGGCTGCCTTTTGTTTCATTGCCGCGTTGGTGATCTTTGTTACCAGTGTTATAAGATCTGAAATGTCCAGAACAAGAAGATACTACTTAAGTGTGATAATAGTGAGTGCTATCCTGGGCATCATGGTGTTTATTGCCACAATTGTCTATATAATGGGAGTGAACCCAACTGCTCAGTCTTCTGGATCTCTATATGGTTCACAAATATATGCCCTCTGCAACCAATTTTATACACCTGCAGCTACTGGACTCTACGTGGATCAGTATTCGTATCACTACTGTGTTGTGGATCCCCAGGAGGCCATTGCCATTGTACTGGGGTTCATGATTATTGTGGCTTTTGCTTTAATAATTTTCTTTGCTGTGAAAACTCGAAGAAAGATGGACAGGTATGACAAGTCCAATATTTTGTGGGACAAGGAACACATTTATGATGAGCAGCCCCCCAATGTCGAGGAGTGGGTTAAAAATGTGTCTGCAGGCACACAGGACGTGCCTTCACCCCCATCTGACTATGTGGAAAGAGTTGACAGTCCCATGGCATACTCTTCCAATGGCAAAGTGAATGACAAGCGGTTTTATCCAGAGTCTTCCTATAAATCCACGCCGGTTCCTGAAGTGGTTCAGGAGCTTCCATTAACTTCGCCTGTGGATGACTTCAGGCAGCCTCGTTACAGCAGCGGTGGTAACTTTGAGACACCTTCAAAAAGAGCACCTGCAAAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAG

Length: 1569

View AllClose

0 Reviews

View AllClose