Human OCLM cDNA Clone BC093987 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016262HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OCLM
Gene ID:
10896
Accession #:
BC093987
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OCLM cDNA Clone BC093987 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OCLM

Gene ID: 10896

Accession Number: BC093987

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGGATGTATCCACCATTATTGTTAAAGATTTACCTTAGCAGACACATTAGTATACTCTTCTATTTAAAAATCCTTTATAAAAGTGGTATTATATGGCTATCCTGGTATTCTTTCATATTGTTAGTACTTTGA

Length: 135

View AllClose

0 Reviews

View AllClose