Human OCIAD1 cDNA Clone BC003409 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL882129HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OCIAD1
Gene ID:
54940
Accession #:
BC003409
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OCIAD1 cDNA Clone BC003409 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OCIAD1

Gene ID: 54940

Accession Number: BC003409

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCAGAGGTTCCAAGACCAATTCCCCACATAGGGCCTGATTACATTCCAACAGAGGAAGAAAGGAGAGTCTTCGCAGAATGCAATGATGAAAGCTTCTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATACTTTCAAGTCATCCCAAATATGGTTCCATCCCTAAACTTATACTTGCTTGTATCATGGGATACTTTGCTGGAAAACTTTCTTATGTGAAAACTTGCCAAGAGAAATTCAAGAAACTTGAAAATTCCCCCCTTGGAGAAGCTTTACGATCAGGACAAGCACGACGATCTTCACCACCTGGGCACTATTATCAAAAGTCAAAATATGACTCAAGTGTGAGTGGTCAATCATCTTTTGTGACATCCCCAGCAGCAGACAACATAGAAATGCTTCCTCATTATGAGCCAATTCCATTCAGTTCTTCTATGAATGAATCTGCTCCCACTGGTATTACTGATCATATTGTCCAAGGACCTGATCCCAACCTTGAAGAAAGTCCTAAAAGAAAAAATATTACATATGAGGAATTAAGGAATAAGAACAGAGAGTCATATGAAGTATCTTTAACACAAAAGACTGACCCCTCAGTCAGGCCTATGCATGAAAGAGTGCCAAAAAAAGAAGTCAAAGTAAACAAGTATGGAGATACTTGGGATGAGTGA

Length: 738

View AllClose

0 Reviews

View AllClose