Human OCEL1 cDNA Clone BC029361 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL875679HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OCEL1
Gene ID:
79629
Accession #:
BC029361
Plasmid:
pUC
€306.00
Frequently bought together:

Description

Human OCEL1 cDNA Clone BC029361 pUC Plasmid | Cusabio

Gene Name: OCEL1

Gene ID: 79629

Accession Number: BC029361

Vector: pUC

Sequence: ATGCACAACCCGGACGGAAGTGCCTCTCCGACAGCAGATCCAGGCTCGGAGCTCCAGACGCTGGGACAGGCCGCCCGCAGACCACCCCCGCCGCGCGCGGGACACGACGCCCCCCGCAGGACCCGCCCATCAGCCCGGAAACCCCTGAGCTGCTTCTCCCGGAGGCCGATGCCCACCCGGGAGCCCCCAAAGACTCGCGGCTCCCGGGGGCACCTGCATACTCACCCGCCTGGGCCTGGGCCCCCGCTGCAGGGACTGGCGCCCCGAGGCCTCAAAACCAGCGCCCCCCGCCCTCCGTGCCAGCCCCAGCCGGGACCCCACAAGGCAAAGACCAAGAAGATTGTGTTTGAGGATGAGTTGCTCTCCCAGGCCCTCCTGGGCGCCAAGAAGCCTATTGGAGCCATCCCTAAGGGGCATAAGCCTAGGCCCCACCCAGTGCCCGACTATGAGCTTAAGTACCCGCCAGTGAGCAGTGAGAGGGAACGGAGCCGCTATGTCGCAGTGTTCCAGGACCAGTACGGAGAGTTCTTGGAGCTCCAGCACGAGGTGGGGTGTGCACAGGCAAAGCTCAGGCAGCTGGAGGCCCTGCTGAGCTCCCTGCCCCCACCCCAAAGCCAGAAGGAGGCCCAAGTTGCAGCCCGGGTTTGGAGGGAGTTTGAGATGAAGCGAATGGATCCTGGCTTCCTGGACAAGCAGGCTCGCTGCCACTACCTGAAGGGTAAACTGAGGCATCTCAAGACTCAGATCCAGAAATTCGATGACCAAGGAGACAGCGAGGGCTCCGTGTACTTCTAA

Length: 795

View AllClose

0 Reviews

View AllClose