Human OBSL1 cDNA Clone BC061909 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016254HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBSL1
Gene ID:
23363
Accession #:
BC061909
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OBSL1 cDNA Clone BC061909 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OBSL1

Gene ID: 23363

Accession Number: BC061909

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGGGGCCCCATCGCCGCCTGGTGCTGCCCGCCACCCAGCCCTCAGACGGGGGCGAGTTTCAGTGCGTCGCTGGAGATGAGTGTGCCTACTTCACTGTCACCATCACAGATGTCTCCTCGTGGATCGTGTATCCCAGCGGCAAGGTGTATGTGGCAGCAGTGCGCCTGGAGCGTGTGGTGCTGA

Length: 186

View AllClose

0 Reviews

View AllClose