null

Human OBSCN cDNA Clone BC098262 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL729422HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBSCN
Gene ID:
84033
Accession #:
BC098262
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OBSCN cDNA Clone BC098262 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OBSCN

Gene ID: 84033

Accession Number: BC098262

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCACTGCACAGTGGATGGAGAAACTGTGATTCTTGTGCTGGGAGGTGGTGGGGCTTCTCCCAGCTACATGGCCAGTGCCAAGCTTGGGAAGGTTCTGTTTCTCCTACTTTCTCGTCTAGGCCCTCCTACCCTAGGGTGGTCTTCCTGACCTGGGCAGTATCTTTGACCTCGTGTGTCCCTCCTTGTCCATCCCCAGAGCCCAAGGTGGTGTTTGCCAAGGAGCAGCCAGCACACAGGGAGGTGCAGGCTGAGGCGGGGGCCAGTGCCACGCTGAGCTGCGAGGTGGCCCAGGCCCAGACAGAGGTGACGTGGTACAAGGATGGGAAGAAGCTGAGTTCCAGCTCGAAAGTGCGCGTGGAGGCCGTGGGCTGCACACGGAGGCTGGTGGTGCAGCAGGCGGGCCAGGCAGAGGCCGGGGAGTACAGCTGCGAGGCAGGGGGTCAGCAGCTCTCCTTCCGCCTGCAGGTGGCAGGTCAGTGCTTTGGGGATGCTGAGTGA

Length: 501

View AllClose

0 Reviews

View AllClose