null

Human OBP2B cDNA Clone BC096717 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL882068HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBP2B
Gene ID:
29989
Accession #:
BC096717
Plasmid:
pUC
€233.00
Frequently bought together:

Description

Human OBP2B cDNA Clone BC096717 pUC Plasmid | Cusabio

Gene Name: OBP2B

Gene ID: 29989

Accession Number: BC096717

Vector: pUC

Sequence: ATGAAGACCCTGTTCCTGGGTGTCACGCTCGGCCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCCAGGAAGGTGTCCCCAGTGAAGGTGACAGCCCTGGGCGGTGGGAAGTTGGAAGCCACGTTCACCTTCATGAGGGAGGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATACAGCGCCTATGGGGGCAGGAAGCTCATGTACCTGCAGGAGCTGCCCAGGAGGGACCACTACATCTTTTACTGCAAAGACCAGCACCATGGGGGCCTGCTCCACATGGGAAAGCTTGTGGGTAGGAATTCTGATACCAACCGGGAGGCCCTGGAAGAATTTAAGAAATTGGTGCAGCGCAAGGGACTCTCGGAGGAGGACATTTTCACGCCCCTGCAGACGGGAAGCTGCGTTCCCGAACACTAG

Length: 513

View AllClose

0 Reviews

View AllClose