Human OBFC2B cDNA Clone BC001079 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL858412HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBFC2B
Gene ID:
79035
Accession #:
BC001079
Plasmid:
pUC
€265.00
Frequently bought together:

Description

Human OBFC2B cDNA Clone BC001079 pUC Plasmid | Cusabio

Gene Name: OBFC2B

Gene ID: 79035

Accession Number: BC001079

Vector: pUC

Sequence: ATGACGACGGAGACCTTTGTGAAGGATATCAAGCCTGGGCTCAAGAATCTGAACCTTATCTTCATTGTGCTGGAGACAGGCCGAGTGACCAAGACAAAGGACGGGCATGAGGTTCGGACCTGCAAAGTGGCGGACAAAACAGGCAGCATCAATATCTCTGTCTGGGACGATGTTGGCAATCTGATCCAGCCTGGGGACATTATCCGGCTCACCAAAGGGTACGCTTCAGTTTTCAAAGGTTGTCTGACACTATATACTGGCCGTGGGGGTGATCTGCAGAAGATTGGAGAATTCTGTATGGTTTATTCTGAGGTTCCTAACTTCAGTGAGCCAAACCCAGAGTACAGCACCCAGCAGGCACCCAACAAGGCGGTGCAGAACGACAGCAACCCTTCAGCTTCCCAGCCTACCACTGGACCCTCTGCTGCCTCTCCAGCCTCTGAGAACCAGAATGGGAATGGACTGAGTGCCCCACCAGGTCCCGGTGGTGGCCCACATCCCCCTCATACTCCCTCCCACCCACCCAGCACCCGAATCACTCGAAGCCAGCCCAACCACACACCTGCAGGCCCGCCTGGCCCTTCCAGCAACCCTGTTAGTAACGGCAAAGAAACCCGGAGGAGCAGCAAGAGATAG

Length: 636

View AllClose

0 Reviews

View AllClose