null

Human OBFC2A cDNA Clone BC017114 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL850257HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBFC2A
Gene ID:
64859
Accession #:
BC017114
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human OBFC2A cDNA Clone BC017114 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OBFC2A

Gene ID: 64859

Accession Number: BC017114

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATAGGGTCAACGACCCACTTATTTTTATAAGAGATATTAAGCCCGGACTGAAAAACTTAAATGTCGTCTTTATTGTCCTGGAGATAGGACGCGTGACCAAAACCAAAGACGGCCATGAAGTGAGATCGTGCAAAGTAGCAGATAAAACGGGCAGCATCACTATTTCCGTGTGGGATGAGATCGGAGGTCTTATACAGCCAGGGGATATTATTCGGTTGACCAGAGGGTATGCATCCATGTGGAAAGGATGTCTGACACTTTATACTGGAAGGGGTGGTGAACTTCAAAAAATTGGGGAATTTTGTATGGTTTATTCAGAAGTGCCAAATTTCAGTGAACCCAACCCAGATTATCGAGGACAGCAGAACAAAGGGGCACAGAGTGAACAGAAGAATAATTCCATGAATAGTAATATGGGTACAGGTACATTTGGACCAGTGGGAAATGGTGTTCACACTGGCCCTGAATCAAGGGAACACCAGTTTTCACATGCTGGCAGAAGCAATGGCCGGGGACTTATAAATCCACAACTACAAGGAACAGCTAGTAATCAAACAGTGATGACCACAATAAGTAATGGCAGGGACCCTCGGAGAGCCTTTAAAAGATGA

Length: 615

View AllClose

0 Reviews

View AllClose