Human OBFC1 cDNA Clone BC017400 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL880983HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OBFC1
Gene ID:
79991
Accession #:
BC017400
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human OBFC1 cDNA Clone BC017400 pENTR223.1 Plasmid | Cusabio

Gene Name: OBFC1

Gene ID: 79991

Accession Number: BC017400

Vector: pENTR223.1

Sequence: ATGCAGCCTGGATCCAGCCGGTGTGAAGAGGAGACCCCTTCCCTCTTGTGGGGTTTGGATCCTGTGTTTCTAGCCTTTGCAAAACTCTACATCAGGGATATCCTGGACATGAAGGAGTCCCGCCAGGTGCCAGGTGTATTTTTGTACAATGGACATCCAATAAAACAGGTAGATGTCTTGGGAACTGTCATTGGAGTGAGAGAAAGAGATGCTTTCTACAGTTATGGAGTGGATGACAGCACTGGAGTTATAAACTGCATCTGCTGGAAAAAGTTGAATACTGAGTCTGTATCAGCTGCTCCTAGTGCAGCAAGAGAGCTCAGCTTAACCTCACAACTTAAGAAGCTACAAGAGACCATTGAGCAGAAAACAAAGATAGAGATCGGGGACACGATCCGAGTCAGAGGCAGTATCCGCACATACAGAGAAGAGCGAGAGATTCATGCCACCGCTTACTATAAAGTGGACGACCCAGTGTGGAACATTCAAATTGCAAGGATGCTTGAGCTGCCCACTATCTACAGGAAAGTTTATGACCAGCCTTTTCACAGCTCAGCCCTAGAGAAAGAAGAGGCACTAAGCAATCCAGGCGCCCTGGACCTCCCCAGTCTCACGAGTTTGCTGAGTGAAAAAGCCAAAGAATTCCTCATGGAGAACAGAGTGCAGAGCTTTTACCAGCAGGAGCTGGAAATGGTGGAGTCTTTGCTGTCCCTTGCCAATCAGCCTGTGATTCACAGTGCCTGCTCCGACCAAGTGAATTTTAAGAAGGACACCACTTCCAAGGCAATTCATAGTATATTTAAGAATGCTATACAACTGCTGCAGGAAAAAGGACTTGTTTTCCAGAAAGATGATGGTTTTGATAACCTATACTATGTAACCAGAGAAGACAAAGACCTGCACAGAAAGATCCACCGGATCATTCAGCAGGACTGCCAGAAACCAAATCACATGGAGAAGGGCTGTCACTTCCTGCACATCTTGGCCTGTGCTCGCCTGAGCATCCGCCCGGGCCTGAGCGAGGCTGTGCTGCAGCAAGTTCTGGAGCTCCTGGAGGACCAGAGTGACATTGTCAGCACAATGGAGCACTACTACACAGCGTTCTGA

Length: 1107

View AllClose

0 Reviews

View AllClose