Human OAZ3 cDNA Clone BC073949 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016247HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAZ3
Gene ID:
51686
Accession #:
BC073949
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OAZ3 cDNA Clone BC073949 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OAZ3

Gene ID: 51686

Accession Number: BC073949

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACCGTGCCCTGGCGGCCAGGAAAGCGACGCATCACTTATAAGGAAGAGGAGGACTTGACACTCCAGCCCCGTCCTGCCTCCAGTGCTCCTGAGTCCCTAGTAGGCCTCCAGGAGGGCAAAAGCACCGAGCAGGGTAACCACGACCAGCTTAAAGAACTGTATTCGGCTGGGAACTTGACGGTGCTGGCTACTGACCCCCTGCTCCACCAGGACCCAGTACAGTTAGACTTTCACTTCCGCCTTACCTCCCAGACCTCTGCCCATTGGCACGGCCTTCTCTGTGACCGTCGACTCTTCCTGGATATCCCATATCAGGCCTTGGATCAAGGCAACCGGGAAAGTTTGACTGCAACCCTGGAGTACGTGGAAGAGAAGACAAATGTGGACTCTGTGTTTGTGAACTTCCAGAATGATCGGAACGACAGAGGTGCCCTGCTGCGGGCCTTCAGCTACATGGGCTTTGAGGTGGTCAGACCAGATCACCCTGCCCTCCCTCCCTTGGACAATGTCATCTTTATGGTGTATCCCCTTGAAAGGGATGTTGGCCACCTGCCCAGTGAGCCTCCTTGA

Length: 573

View AllClose

0 Reviews

View AllClose