Human OASL cDNA Clone BC117408 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL614897HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OASL
Gene ID:
8638
Accession #:
BC117408
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human OASL cDNA Clone BC117408 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OASL

Gene ID: 8638

Accession Number: BC117408

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCACTGATGCAGGAACTGTATAGCACACCAGCCTCCAGGCTGGACTCCTTCGTGGCTCAGTGGCTGCAGCCCCACCGGGAGTGGAAGGAAGAGGTGCTAGACGCTGTGCGGACCGTGGAGGAGTTTCTGAGGCAGGAGCATTTCCAGGGGAAGCGTGGGCTGGACCAGGATGTGCGGGTGCTGAAGGTAGTCAAGGTGGGCTCCTTCGGGAATGGCACGGTTCTCAGGAGCACCAGAGAGGTGGAGCTGGTGGCGTTTCTGAGCTGTTTCCACAGCTTCCAGGAGGCAGCCAAGCATCACAAAGATGTTCTGAGGCTGATATGGAAAACCATGTGGCAAAGCCAGGACCTGCTGGACCTCGGGCTCGAGGACCTGAGGATGGAGCAGAGAGTCCCCGATGCTCTTGTCTTCACCATCCAGACCAGGGGGACTGCGGAGCCCATCACGGTCACCATTGTGCCTGCCTACAGAGCCCTGGGGCCTTCTCTTCCCAACTCCCAGCCACCCCCTGAGGTCTATGTGAGCCTGATCAAGGCCTGCGGTGGTCCTGGAAATTTCTGCCCATCCTTCAGCGAGCTGCAGAGAAATTTCGTGAAACATCGGCCAACTAAGCTGAAGAGCCTCCTGCGCCTGGTGAAACACTGGTACCAGCAGTATGTGAAAGCCAGGTCCCCCAGAGCCAATCTGCCCCCTCTCTATGCTCTTGAACTTCTAACCATCTATGCCTGGGAAATGGGTACTGAAGAAGACGAGAATTTCATGTTGGACGAAGGCTTCACCACTGTGATGGACCTGCTCCTGGAGTATGAAGTCATCTGTATCTACTGGACCAAGTACTACACACTCCACAATGCAATCATTGAGGATTGTGTCAGAAAACAGCTCAAAAAAGAGAGGCCCATCATCCTGGATCCGGCCGACCCCACCCTCAACGTGGCAGAAGGGTACAGATGGGACATCGTTGCTCAGAGGGCCTCCCAGTGCCTGAAACAGGACTGTTGCTATGACAACAGGGAGAACCCCATCTCCAGCTGGAACGTGAAGAGGGCACGAGACATCCACTTGACAGTGGAGCAGAGGGGTTACCCAGATTTCAACCTCATCGTGAACCCTTATGAGCCCATAAGGAAGGTTAAAGAGAAAATCCGGAGGACCAGGGGCTACTCTGGCCTGCAGCGTCTGTCCTTCCAGGTTCCTGGCAGTGAGAGGCAGCTTCTCAGCAGCAGGTGCTCCTTAGCCAAATATGGGATCTTCTCCCACACTCACATCTATCTGCTGGAGACCATCCCCTCCGAGATCCAGGTCTTCGTGAAGAATCCTGATGGTGGGAGCTACGCCTATGCCATCAACCCCAACAGCTTCATCCTGGGTCTGAAGCAGCAGATTGAAGACCAGCAGGGGCTTCCTAAAAAGCAGCAGCAGCTGGAATTCCAAGGCCAAGTCCTGCAGGACTGGTTGGGTCTGGGGATCTATGGCATCCAAGACAGTGACACTCTCATCCTCTCGAAGAAGAAAGGAGAGGCTCTGTTTCCAGCCAGTTAG

Length: 1545

View AllClose

0 Reviews

View AllClose