Human OAS3 cDNA Clone BC113746 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL897591HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAS3
Gene ID:
4940
Accession #:
BC113746
Plasmid:
pUC
€1,078.00
Frequently bought together:

Description

Human OAS3 cDNA Clone BC113746 pUC Plasmid | Cusabio

Gene Name: OAS3

Gene ID: 4940

Accession Number: BC113746

Vector: pUC

Sequence: ATGGACTTGTACAGCACCCCGGCCGCTGCGCTGGACAGGTTCGTGGCCAGAAGGCTGCAGCCGCGGAAGGAGTTCGTAGAGAAGGCGCGGCGCGCTCTGGGCGCCCTGGCCGCTGCCCTGAGGGAGCGCGGGGGCCGCCTCGGTGCTGCTGCCCCGCGGGTGCTGAAAACTGTCAAGGGAGGCTCCTCGGGCCGGGGCACAGCTCTCAAGGGTGGCTGTGATTCTGAACTTGTCATCTTCCTCGACTGCTTCAAGAGCTATGTGGACCAGAGGGCCCGCCGTGCAGAGATCCTCAGTGAGATGCGGGCATCGCTGGAATCCTGGTGGCAGAACCCAGTCCCTGGTCTGAGACTCACGTTTCCTGAGCAGAGCGTGCCTGGGGCCCTGCAGTTCCGCCTGACATCCGTAGATCTTGAGGACTGGATGGATGTTAGCCTGGTGCCTGCCTTCAATGTCCTGGGTCAGGCCGGCTCCGGCGTCAAACCCAAGCCACAAGTCTACTCTACCCTCCTCAACAGTGGCTGCCAAGGGGGCGAGCATGCGGCCTGCTTCACAGAGCTGCGGAGGAACTTTGTGAACATTCGCCCAGCCAAGTTGAAGAACCTAATCTTGCTGGTGAAGCACTGGTACCACCAGGTGTGCCTACAGGGGTTGTGGAAGGAGACGCTGCCCCCGGTCTATGCCCTGGAATTGCTGACCATCTTCGCCTGGGAGCAGGGCTGTAAGAAGGATGCTTTCAGCCTAGCCGAAGGCCTCCGAACTGTCCTGGGCCTGATCCAACAGCATCAGCACCTGTGTGTTTTCTGGACTGTCAACTATGGCTTCGAGGACCCTGCAGTTGGGCAGTTCTTGCAGCGGCAGCTTAAGAGACCCAGGCCTGTGATCCTGGACCCAGCTGACCCCACATGGGACCTGGGGAATGGGGCAGCCTGGCACTGGGATTTGCTAGCCCAGGAGGCAGCATCCTGCTATGACCACCCATGCTTTCTGAGGGGGATGGGGGACCCAGTGCAGTCTTGGAAGGGGCCGGGCCTTCCACGTGCTGGATGCTCAGGTTTGGGCCACCCCATCCAGCTAGACCCTAACCAGAAGACCCCTGAAAACAGCAAGAGCCTCAATGCTGTGTACCCAAGAGCAGGGAGGAAACCTCCCTCATGCCCAGCTCCTGGCCCCACTGGGGCAGCCAGCATCGTCCCCTCTGTGCCGGGAATGGCCTTGGACCTGTCTCAGATCCCCACCAAGGAGCTGGACCGCTTCATCCAGGACCACCTGAAGCCGAGCCCCCAGTTCCAGGAGCAGGTGAAAAAGGCCATCGACATCATCTTGCGCTGCCTCCATGAGAACTGTGTTCACAAGGCCTCAAGAGTCAGTAAAGGGGGCTCATTTGGCCGGGGCACAGACCTAAGGGATGGCTGTGATGTTGAACTCATCATCTTCCTCAACTGCTTCACGGACTACAAGGACCAGGGGCCCCGCCGCGCAGAGATCCTTGATGAGATGCGAGCGCAGCTAGAATCCTGGTGGCAGGACCAGGTGCCCAGCCTGAGCCTTCAGTTTCCTGAGCAGAATGTGCCTGAGGCTCTGCAGTTCCAGCTGGTGTCCACAGCCCTGAAGAGCTGGACGGATGTTAGCCTGCTGCCTGCCTTCGATGCTGTGGGGCAGCTCAGTTCTGGCACCAAACCAAATCCCCAGGTCTACTCGAGGCTCCTCACCAGTGGCTGCCAGGAGGGCGAGCATAAGGCCTGCTTCGCAGAGCTGCGGAGGAACTTCATGAACATTCGCCCTGTCAAGCTGAAGAACCTGATTCTGCTGGTGAAGCACTGGTACCGCCAGGTTGCGGCTCAGAACAAAGGAAAAGGACCAGCCCCTGCCTCTCTGCCCCCAGCCTATGCCCTGGAGCTCCTCACCATCTTTGCCTGGGAGCAGGGCTGCAGGCAGGATTGTTTCAACATGGCCCAAGGCTTCCGGACGGTGCTGGGGCTCGTGCAACAGCATCAGCAGCTCTGTGTCTACTGGACGGTCAACTATAGCACTGAGGACCCAGCCATGAGAATGCACCTTCTTGGCCAGCTTCGAAAACCCAGACCCCTGGTCCTGGACCCCGCTGATCCCACCTGGAACGTGGGCCACGGTAGCTGGGAGCTGTTGGCCCAGGAAGCAGCAGCGCTGGGGATGCAGGCCTGCTTTCTGAGTAGAGACGGGACATCTGTGCAGCCCTGGGATGTGATGCCAGCCCTCCTTTACCAAACCCCAGCTGGGGACCTTGACAAGTTCATCAGTGAATTTCTCCAGCCCAACCGCCAGTTCCTGGCCCAGGTGAACAAGGCCGTTGATACCATCTGTTCATTTTTGAAGGAAAACTGCTTCCGGAATTCTCCCATCAAAGTGATCAAGGTGGTCAAGGGTGGCTCTTCAGCCAAAGGCACAGCTCTGCGAGGCCGCTCAGATGCCGACCTCGTGGTGTTCCTCAGCTGCTTCAGCCAGTTCACTGAGCAGGGCAACAAGCGGGCCGAGATCATCTCCGAGATCCGAGCCCAGTTGGAGGCATGTCAACAGGAGCGGCAGTTCGAGGTCAAGTTTGAAGTCTCCAAATGGGAGAATCCCCGCGTGCTGAGCTTCTCACTGACATCCCAGACGATGCTGGACCAGAGTGTGGACTTTGATGTGCTGCCAGCCTTTGACGCCCTAGGCCAGCTGGTCTCTGGCTCCAGGCCCAGCTCTCAAGTCTACGTCGACCTCATCCACAGCTACAGCAATGCGGGCGAGTACTCCACCTGCTTCACAGAGCTACAACGGGACTTCATCATCTCTCGCCCTACCAAGCTGAAGAGCCTGATCCGGCTGGTGAAGCACTGGTACCAGCAGTGTACCAAGATCTCCAAGGGGAGAGGCTCCCTACCCCCACAGCACGGGCTGGAACTCCTGACTGTGTATGCCTGGGAGCAGGGCGGGAAGGACTCCCAGTTCAACATGGCTGAGGGCTTCCGCACGGTCCTGGAGCTGGTCACCCAGTACCGCCAGCTCTGTATCTACTGGACCATCAACTACAACGCCAAGGACAAGACTGTTGGAGACTTCCTGAAACAGCAGCTTCAGAAGCCCAGGCCTATCATCCTGGATCCGGCTGACCCGACAGGCAACCTGGGCCACAATGCCCGCTGGGACCTGCTGGCCAAGGAAGCTGCAGCCTGCACATCTGCCCTGTGCTGCATGGGACGGAATGGCATCCCCATCCAGCCATGGCCAGTGAAGGCTGCTGTGTGA

Length: 3264

View AllClose

0 Reviews

View AllClose