Human OAF cDNA Clone BC047726 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL803119HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAF
Gene ID:
220323
Accession #:
BC047726
Plasmid:
pUC
€313.00
Frequently bought together:

Description

Human OAF cDNA Clone BC047726 pUC Plasmid | Cusabio

Gene Name: OAF

Gene ID: 220323

Accession Number: BC047726

Vector: pUC

Sequence: ATGCGCCTTCCCGGGGTACCCCTGGCGCGCCCTGCGCTGCTGCTGCTGCTGCCGCTGCTCGCGCCGCTGCTGGGAACGGGTGCGCCGGCCGAGCTGCGGGTCCGCGTGCGGCTGCCGGACGGCCAGGTGACCGAGGAGAGCCTGCAGGCGGACAGCGACGCGGACAGCATCAGCCTCGAGCTGCGCAAGCCCGACGGCACCCTCGTCTCCTTCACCGCCGACTTCAAGAAGGATGTGAAGGTCTTCCGGGCCCTGATCCTGGGGGAGCTGGAGAAGGGGCAGAGTCAGTTCCAGGCCCTCTGCTTTGTCACCCAGCTGCAGCACAATGAGATCATCCCCAGTGAGGCCATGGCCAAGCTCCGGCAGAAAAATCCCCGGGCAGTGCGGCAGGCGGAGGAGGTTCGGGGTCTGGAGCATCTGCACATGGATGTCGCTGTCAACTTCAGCCAGGGGGCCCTGCTGAGCCCCCATCTCCACAACGTGTGTGCCGAGGCCGTGGATGCCATCTACACCCGCCAGGAGGATGTCCGGTTCTGGCTGGAGCAAGGTGTGGACAGTTCTGTGTTCGAGGCTCTGCCCAAGGCCTCAGAGCAGGCGGAGCTGCCTCGCTGCAGGCAGGTGGGGGACCACGGGAAGCCCTGCGTCTGCCGCTATGGCCTGAGCCTGGCCTGGTACCCCTGCATGCTCAAGTACTGCCACAGCCGCGACCGGCCCACGCCCTACAAGTGTGGCATCCGCAGCTGCCAGAAGAGCTACAGCTTCGACTTCTACGTGCCCCAGAGGCAGCTGTGTCTCTGGGATGAGGATCCCTACCCAGGCTAG

Length: 822

View AllClose

0 Reviews

View AllClose