Cusabio Customized Plasmid
Human NHP2L1 cDNA Clone BC005358 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL015794HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- NHP2L1
- Gene ID:
- 4809
- Accession #:
- BC005358
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human NHP2L1 cDNA Clone BC005358 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: NHP2L1
Gene ID: 4809
Accession Number: BC005358
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGACTGAGGCTGATGTGAATCCAAAGGCCTACCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAA
Length: 387
Related Products
Human NHP2L1 cDNA Clone BC019282 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL015794HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- NHP2L1
- Gene ID:
- 4809
- Accession #:
- BC019282
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL009118HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC
- Gene ID:
- 2538
- Accession #:
- BC130478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL861153HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FUNDC2
- Gene ID:
- 65991
- Accession #:
- BC000255
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL873624HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC2
- Gene ID:
- 57818
- Accession #:
- BC113376
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC