null

Human NCK2 cDNA Clone BC000103 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL015531HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
NCK2
Gene ID:
8440
Accession #:
BC000103
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human NCK2 cDNA Clone BC000103 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: NCK2

Gene ID: 8440

Accession Number: BC000103

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAGCTGGACATCAAGAAGAACGAGCGGCTGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGGGTGAGGAACGCGGCCAACAGGACGGGCTATGTACCGTCCAACTACGTGGAGCGGAAGAACAGCCTGAAGAAGGGCTCCCTCGTGAAGAACCTGAAGGACACACTAGGCCTCGGCAAGACGCGCAGGAAGACCAGCGCGCGGGATGCGTCCCCCACGCCCAGCACGGACGCCGAGTACCCCGCCAATGGCAGCGGCGCCGACCGCATCTACGACCTCAACATCCCGGCCTTCGTCAAGTTCGCCTATGTGGCCGAGCGGGAGGATGAGTTGTCCCTGGTGAAGGGGTCGCGCGTCACCGTCATGGAGAAGTGCAGCGACGGTTGGTGGCGGGGCAGCTACAACGGGCAGATCGGCTGGTTCCCCTCCAACTACGTCTTGGAGGAGGTGGACGAGGCGGCTGCGGAGTCCCCAAGCTTCCTGAGCCTGCGCAAGGGCGCCTCGCTGAGCAATGGCCAGGGCTCCCGCGTGCTGCATGTGGTCCAGACGCTGTACCCCTTCAGCTCAGTCACCGAGGAGGAGCTCAACTTCGAGAAGGGGGAGACCATGGAGGTGATTGAGAAGCCGGAGAACGACCCCGAGTGGTGGAAATGCAAAAATGCCCGGGGCCAGGTGGGCCTCGTCCCCAAAAACTACGTGGTGGTCCTCAGTGACGGGCCTGCCCTGCACCCTGCGCACGCCCCACAGATAAGCTACACCGGGCCCTCGTCCAGCGGGCGCTTCGCGGGCAGAGAGTGGTACTACGGGAACGTGACGCGGCACCAGGCCGAGTGCGCCCTCAACGAGCGGGGCGTGGAGGGCGACTTCCTCATTAGGGACAGCGAGTCCTCGCCCAGCGACTTCTCCGTGTCCCTTAAAGCGTCAGGGAAGAACAAACACTTCAAGGTGCAGCTCGTGGACAATGTCTACTGCATTGGGCAGCGGCGCTTCCACACCATGGACGAGCTGGTGGAACACTACAAAAAGGCGCCCATCTTCACCAGCGAGCACGGGGAGAAGCTCTACCTCGTCAGGGCCCTGCAGTGA

Length: 1143

View AllClose

0 Reviews

View AllClose